Human SVBP ORF/cDNA clone-Adenovirus particle (BC029427)
Pre-made Human SVBP/ Adenovirus for SVBP overexpression in-vitro and in-vivo. The SVBP adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified SVBP-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to SVBP/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000517 | Human SVBP Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000517 |
Gene Name | SVBP |
Accession Number | BC029427 |
Gene ID | 374969 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 201 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGATCCACCTGCACGTAAAGAAAAAACCAAAGTTAAAGAATCTGTCAGCAGAGTTGAGAAGGCCAAACAGAAATCAGCCCAGCAGGAGCTGAAGCAGAGACAAAGAGCAGAGATCTATGCCCTCAACAGAGTCATGACAGAACTGGAGCAGCAGCAGTTTGATGAGTTCTGTAAACAGATGCAGCCTCCTGGAGAATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1327-Ab | Anti-SVBP/ CCDC23 functional antibody |
Target Antigen | GM-Tg-g-SE1327-Ag | SVBP protein |
ORF Viral Vector | pGMAP000413 | Human SVBP Adenovirus plasmid |
ORF Viral Vector | pGMAP000517 | Human SVBP Adenovirus plasmid |
ORF Viral Vector | vGMAP000413 | Human SVBP Adenovirus particle |
ORF Viral Vector | vGMAP000517 | Human SVBP Adenovirus particle |
Target information
Target ID | GM-SE1327 |
Target Name | SVBP |
Gene ID | 374969, 69216, 698308, 362578, 101094775, 100683368, 614073, 100053543 |
Gene Symbol and Synonyms | 2410005K17Rik,CCDC23,NEDAHM,RGD1311232,SVBP |
Uniprot Accession | Q8N300 |
Uniprot Entry Name | SVBP_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000177868 |
Target Classification | Not Available |
Enables microtubule binding activity. Involved in axon development; proteolysis; and regulation of metallopeptidase activity. Acts upstream of or within negative regulation of endothelial cell migration; negative regulation of protein ubiquitination; and protein secretion. Located in apical part of cell. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.