Human MBL2/COLEC1/ HSMBPC ORF/cDNA clone-Lentivirus particle (NM_000242)

Pre-made Human MBL2/COLEC1/ HSMBPC Lentiviral expression plasmid for MBL2 lentivirus packaging, MBL2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to MBL2/COLEC1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000559 Human MBL2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000559
Gene Name MBL2
Accession Number NM_000242
Gene ID 4153
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 747 bp
Gene Alias COLEC1, HSMBPC, MBL, MBL2D, MBP, MBP-C, MBP1, MBPD
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCCCTGTTTCCATCACTCCCTCTCCTTCTCCTGAGTATGGTGGCAGCGTCTTACTCAGAAACTGTGACCTGTGAGGATGCCCAAAAGACCTGCCCTGCAGTGATTGCCTGTAGCTCTCCAGGCATCAACGGCTTCCCAGGCAAAGATGGGCGTGATGGCACCAAGGGAGAAAAGGGGGAACCAGGCCAAGGGCTCAGAGGCTTACAGGGCCCCCCTGGAAAGTTGGGGCCTCCAGGAAATCCAGGGCCTTCTGGGTCACCAGGACCAAAGGGCCAAAAAGGAGACCCTGGAAAAAGTCCGGATGGTGATAGTAGCCTGGCTGCCTCAGAAAGAAAAGCTCTGCAAACAGAAATGGCACGTATCAAAAAGTGGCTCACCTTCTCTCTGGGCAAACAAGTTGGGAACAAGTTCTTCCTGACCAATGGTGAAATAATGACCTTTGAAAAAGTGAAGGCCTTGTGTGTCAAGTTCCAGGCCTCTGTGGCCACCCCCAGGAATGCTGCAGAGAATGGAGCCATTCAGAATCTCATCAAGGAGGAAGCCTTCCTGGGCATCACTGATGAGAAGACAGAAGGGCAGTTTGTGGATCTGACAGGAAATAGACTGACCTACACAAACTGGAACGAGGGTGAACCCAACAATGCTGGTTCTGATGAAGATTGTGTATTGCTACTGAAAAATGGCCAGTGGAATGACGTCCCCTGCTCCACCTCCCATCTGGCCGTCTGTGAGTTCCCTATCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T32699-Ab Anti-MBL2/ COLEC1/ HSMBPC functional antibody
    Target Antigen GM-Tg-g-T32699-Ag MBL2 protein
    ORF Viral Vector pGMLP000559 Human MBL2 Lentivirus plasmid
    ORF Viral Vector pGMAP000529 Human MBL2 Adenovirus plasmid
    ORF Viral Vector vGMLP000559 Human MBL2 Lentivirus particle
    ORF Viral Vector vGMAP000529 Human MBL2 Adenovirus particle


    Target information

    Target ID GM-T32699
    Target Name MBL2
    Gene ID 4153, 17195, 702652, 64668, 101100840, 281297, 100034103
    Gene Symbol and Synonyms Ab2-001,Ab2-011,COLEC1,HSMBPC,L-MBP,MBL,MBL-C,MBL1,MBL2,MBL2D,MBP,MBP-C,MBP1,MBPD,RARF/P28A
    Uniprot Accession P11226
    Uniprot Entry Name MBL2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000165471
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes the soluble mannose-binding lectin or mannose-binding protein found in serum. The protein encoded belongs to the collectin family and is an important element in the innate immune system. The protein recognizes and binds to mannose and N-acetylglucosamine on many microorganisms, including bacteria, yeast, and viruses including influenza virus, HIV and SARS-CoV. This binding activates the classical complement pathway. Deficiencies of this gene have been associated with susceptibility to autoimmune and infectious diseases. [provided by RefSeq, Jun 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.