Human MBL2/COLEC1/ HSMBPC ORF/cDNA clone-Adenovirus particle (BC096179)

Pre-made Human MBL2/COLEC1/ HSMBPC Adenovirus for MBL2 overexpression in-vitro and in-vivo. The MBL2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MBL2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to MBL2/COLEC1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000529 Human MBL2 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000529
Gene Name MBL2
Accession Number BC096179
Gene ID 4153
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 747 bp
Gene Alias COLEC1, HSMBPC, MBP, MBP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCCCTGTTTCCATCACTCCCTCTCCTTCTCCTGAGTATGGTGGCAGCGTCTTACTCAGAAACTGTGACCTGTGAGGATGCCCAAAAGACCTGCCCTGCAGTGATTGCCTGTAGCTCTCCAGGCATCAACGGCTTCCCAGGCAAAGATGGGCGTGATGGCACCAAGGGAGAAAAGGGGGAACCAGGCCAAGGGCTCAGAGGCTTACAGGGCCCCCCTGGAAAGTTGGGGCCTCCAGGAAATCCAGGGCCTTCTGGGTCACCAGGACCAAAGGGCCAAAAAGGAGACCCTGGAAAAAGTCCGGATGGTGATAGTAGCCTGGCTGCCTCAGAAAGAAAAGCTCTGCAAACAGAAATGGCACGTATCAAAAAGTGGCTCACCTTCTCTCTGGGCAAACAAGTTGGGAACAAGTTCTTCCTGACCAATGGTGAAATAATGACCTTTGAAAAAGTGAAGGCCTTGTGTGTCAAGTTCCAGGCCTCTGTGGCCACCCCCAGGAATGCTGCAGAGAATGGAGCCATTCAGAATCTCATCAAGGAGGAAGCCTTCCTGGGCATCACTGATGAGAAGACAGAAGGGCAGTTTGTGGATCTGACAGGAAATAGACTGACCTACACAAACTGGAACGAGGGTGAACCCAACAATGCTGGTTCTGATGAAGATTGTGTATTGCTACTGAAAAATGGCCAGTGGAATGACGTCCCCTGCTCCACCTCCCATCTGGCCGTCTGTGAGTTCCCTATCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T32699-Ab Anti-MBL2/ COLEC1/ HSMBPC functional antibody
    Target Antigen GM-Tg-g-T32699-Ag MBL2 protein
    ORF Viral Vector pGMLP000559 Human MBL2 Lentivirus plasmid
    ORF Viral Vector pGMAP000529 Human MBL2 Adenovirus plasmid
    ORF Viral Vector vGMLP000559 Human MBL2 Lentivirus particle
    ORF Viral Vector vGMAP000529 Human MBL2 Adenovirus particle


    Target information

    Target ID GM-T32699
    Target Name MBL2
    Gene ID 4153, 17195, 702652, 64668, 101100840, 281297, 100034103
    Gene Symbol and Synonyms Ab2-001,Ab2-011,COLEC1,HSMBPC,L-MBP,MBL,MBL-C,MBL1,MBL2,MBL2D,MBP,MBP-C,MBP1,MBPD,RARF/P28A
    Uniprot Accession P11226
    Uniprot Entry Name MBL2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000165471
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes the soluble mannose-binding lectin or mannose-binding protein found in serum. The protein encoded belongs to the collectin family and is an important element in the innate immune system. The protein recognizes and binds to mannose and N-acetylglucosamine on many microorganisms, including bacteria, yeast, and viruses including influenza virus, HIV and SARS-CoV. This binding activates the classical complement pathway. Deficiencies of this gene have been associated with susceptibility to autoimmune and infectious diseases. [provided by RefSeq, Jun 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.