Human MBL2/COLEC1/ HSMBPC ORF/cDNA clone-Adenovirus plasmid (BC096179)
Pre-made Human MBL2/COLEC1/ HSMBPC adenoviral expression plasmid for MBL2 adenovirus packaging, MBL2 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to MBL2/COLEC1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000529 | Human MBL2 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000529 |
Gene Name | MBL2 |
Accession Number | BC096179 |
Gene ID | 4153 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 747 bp |
Gene Alias | COLEC1, HSMBPC, MBP, MBP1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCCCTGTTTCCATCACTCCCTCTCCTTCTCCTGAGTATGGTGGCAGCGTCTTACTCAGAAACTGTGACCTGTGAGGATGCCCAAAAGACCTGCCCTGCAGTGATTGCCTGTAGCTCTCCAGGCATCAACGGCTTCCCAGGCAAAGATGGGCGTGATGGCACCAAGGGAGAAAAGGGGGAACCAGGCCAAGGGCTCAGAGGCTTACAGGGCCCCCCTGGAAAGTTGGGGCCTCCAGGAAATCCAGGGCCTTCTGGGTCACCAGGACCAAAGGGCCAAAAAGGAGACCCTGGAAAAAGTCCGGATGGTGATAGTAGCCTGGCTGCCTCAGAAAGAAAAGCTCTGCAAACAGAAATGGCACGTATCAAAAAGTGGCTCACCTTCTCTCTGGGCAAACAAGTTGGGAACAAGTTCTTCCTGACCAATGGTGAAATAATGACCTTTGAAAAAGTGAAGGCCTTGTGTGTCAAGTTCCAGGCCTCTGTGGCCACCCCCAGGAATGCTGCAGAGAATGGAGCCATTCAGAATCTCATCAAGGAGGAAGCCTTCCTGGGCATCACTGATGAGAAGACAGAAGGGCAGTTTGTGGATCTGACAGGAAATAGACTGACCTACACAAACTGGAACGAGGGTGAACCCAACAATGCTGGTTCTGATGAAGATTGTGTATTGCTACTGAAAAATGGCCAGTGGAATGACGTCCCCTGCTCCACCTCCCATCTGGCCGTCTGTGAGTTCCCTATCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T32699-Ab | Anti-MBL2/ COLEC1/ HSMBPC functional antibody |
Target Antigen | GM-Tg-g-T32699-Ag | MBL2 protein |
ORF Viral Vector | pGMLP000559 | Human MBL2 Lentivirus plasmid |
ORF Viral Vector | pGMAP000529 | Human MBL2 Adenovirus plasmid |
ORF Viral Vector | vGMLP000559 | Human MBL2 Lentivirus particle |
ORF Viral Vector | vGMAP000529 | Human MBL2 Adenovirus particle |
Target information
Target ID | GM-T32699 |
Target Name | MBL2 |
Gene ID | 4153, 17195, 702652, 64668, 101100840, 281297, 100034103 |
Gene Symbol and Synonyms | Ab2-001,Ab2-011,COLEC1,HSMBPC,L-MBP,MBL,MBL-C,MBL1,MBL2,MBL2D,MBP,MBP-C,MBP1,MBPD,RARF/P28A |
Uniprot Accession | P11226 |
Uniprot Entry Name | MBL2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000165471 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes the soluble mannose-binding lectin or mannose-binding protein found in serum. The protein encoded belongs to the collectin family and is an important element in the innate immune system. The protein recognizes and binds to mannose and N-acetylglucosamine on many microorganisms, including bacteria, yeast, and viruses including influenza virus, HIV and SARS-CoV. This binding activates the classical complement pathway. Deficiencies of this gene have been associated with susceptibility to autoimmune and infectious diseases. [provided by RefSeq, Jun 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.