Human CD70/CD27-L/ CD27L ORF/cDNA clone-Lentivirus particle (NM_001252)

Pre-made Human CD70/CD27-L/ CD27L Lentiviral expression plasmid for CD70 lentivirus packaging, CD70 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CD27-L/CD70 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002733 Human CD70 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002733
Gene Name CD70
Accession Number NM_001252
Gene ID 970
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 582 bp
Gene Alias CD27-L, CD27L, CD27LG, TNFSF7, TNLG8A
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCGGAGGAGGGTTCGGGCTGCTCGGTGCGGCGCAGGCCCTATGGGTGCGTCCTGCGGGCTGCTTTGGTCCCATTGGTCGCGGGCTTGGTGATCTGCCTCGTGGTGTGCATCCAGCGCTTCGCACAGGCTCAGCAGCAGCTGCCGCTCGAGTCACTTGGGTGGGACGTAGCTGAGCTGCAGCTGAATCACACAGGACCTCAGCAGGACCCCAGGCTATACTGGCAGGGGGGCCCAGCACTGGGCCGCTCCTTCCTGCATGGACCAGAGCTGGACAAGGGGCAGCTACGTATCCATCGTGATGGCATCTACATGGTACACATCCAGGTGACGCTGGCCATCTGCTCCTCCACGACGGCCTCCAGGCACCACCCCACCACCCTGGCCGTGGGAATCTGCTCTCCCGCCTCCCGTAGCATCAGCCTGCTGCGTCTCAGCTTCCACCAAGGTTGTACCATTGCCTCCCAGCGCCTGACGCCCCTGGCCCGAGGGGACACACTCTGCACCAACCTCACTGGGACACTTTTGCCTTCCCGAAACACTGATGAGACCTTCTTTGGAGTGCAGTGGGTGCGCCCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-630 Pre-Made Vorsetuzumab biosimilar, Whole mAb ADC, Anti-CD70/CD27-L Antibody: Anti-CD27L/LPFS3/CD27LG/TNFSF7/TNLG8A therapeutic antibody
    Biosimilar GMP-Bios-ab-127 Pre-Made Cusatuzumab biosimilar, Whole mAb, Anti-CD70/CD27-L Antibody: Anti-CD27L/LPFS3/CD27LG/TNFSF7/TNLG8A therapeutic antibody
    Biosimilar GMP-Bios-INN-1050 Pre-Made Vorsetuzumab Mafodotin Biosimilar, Whole Mab Adc, Anti-CD70/CD27-L Antibody: Anti-CD27LG/LPFS3/TNFSF7/TNLG8A therapeutic antibody Drug Conjugate
    Target Antibody GM-Tg-g-T67805-Ab Anti-CD70/ CD27-L/ CD27L monoclonal antibody
    Target Antigen GM-Tg-g-T67805-Ag CD27-L/CD70 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T67805 CD70 antigen (CD70) protein & antibody
    ORF Viral Vector pGMLV001133 Human CD70 Lentivirus plasmid
    ORF Viral Vector pGMLP002733 Human CD70 Lentivirus plasmid
    ORF Viral Vector vGMLV001133 Human CD70 Lentivirus particle
    ORF Viral Vector vGMLP002733 Human CD70 Lentivirus particle
    ORF Viral Vector pGMLV002123 Human CD70 Lentivirus plasmid


    Target information

    Target ID GM-T67805
    Target Name CD27-L
    Gene ID 970, 21948, 701080, 301132, 101087455, 485018, 522074, 100065854
    Gene Symbol and Synonyms CD27-L,CD27L,CD27LG,CD70,LPFS3,TNFSF7,TNLG8A
    Uniprot Accession P32970
    Uniprot Entry Name CD70_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000125726
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF27/CD27. It is a surface antigen on activated, but not on resting, T and B lymphocytes. It induces proliferation of costimulated T cells, enhances the generation of cytolytic T cells, and contributes to T cell activation. This cytokine is also reported to play a role in regulating B-cell activation, cytotoxic function of natural killer cells, and immunoglobulin sythesis. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.