Human TIMP3/HSMRK222/ K222 ORF/cDNA clone-Adenovirus plasmid (BC014277)
Pre-made Human TIMP3/HSMRK222/ K222 adenoviral expression plasmid for TIMP3 adenovirus packaging, TIMP3 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to TIMP3/HSMRK222 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000031 | Human TIMP3 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000031 |
Gene Name | TIMP3 |
Accession Number | BC014277 |
Gene ID | 7078 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 636 bp |
Gene Alias | HSMRK222, K222, K222TA2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACCCCTTGGCTCGGGCTCATCGTGCTCCTGGGCAGCTGGAGCCTGGGGGACTGGGGCGCCGAGGCGTGCACATGCTCGCCCAGCCACCCCCAGGACGCCTTCTGCAACTCCGACATCGTGATCCGGGCCAAGGTGGTGGGGAAGAAGCTGGTAAAGGAGGGGCCCTTCGGCACGCTGGTCTACACCATCAAGCAGATGAAGATGTACCGAGGCTTCACCAAGATGCCCCATGTGCAGTACATCCATACGGAAGCTTCCGAGAGTCTCTGTGGCCTTAAGCTGGAGGTCAACAAGTACCAGTACCTGCTGACAGGTCGCGTCTATGATGGCAAGATGTACACGGGGCTGTGCAACTTCGTGGAGAGGTGGGACCAGCTCACCCTCTCCCAGCGCAAGGGGCTGAACTATCGGTATCACCTGGGTTGTAACTGCAAGATCAAGTCCTGCTACTACCTGCCTTGCTTTGTGACTTCCAAGAACGAGTGTCTCTGGACCGACATGCTCTCCAATTTCGGTTACCCTGGCTACCAGTCCAAACACTACGCCTGCATCCGGCAGAAGGGCGGCTACTGCAGCTGGTACCGAGGATGGGCCCCCCCGGATAAAAGCATCATCAATGCCACAGACCCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1339-Ab | Anti-TIMP3/ HSMRK222/ K222 functional antibody |
Target Antigen | GM-Tg-g-SE1339-Ag | TIMP3 protein |
ORF Viral Vector | pGMPC000772 | Human TIMP3 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP000407 | Human TIMP3 Lentivirus plasmid |
ORF Viral Vector | pGMAP000031 | Human TIMP3 Adenovirus plasmid |
ORF Viral Vector | vGMLP000407 | Human TIMP3 Lentivirus particle |
ORF Viral Vector | vGMAP000031 | Human TIMP3 Adenovirus particle |
Target information
Target ID | GM-SE1339 |
Target Name | TIMP3 |
Gene ID | 7078, 21859, 574381, 25358, 101091215, 481289, 282094, 100033947 |
Gene Symbol and Synonyms | HSMRK222,K222,K222TA2,SFD,Timp-3,TIMP3 |
Uniprot Accession | P35625 |
Uniprot Entry Name | TIMP3_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Juvenile astrocytoma |
Gene Ensembl | ENSG00000100234 |
Target Classification | Not Available |
This gene belongs to the TIMP gene family. The proteins encoded by this gene family are inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix (ECM). Expression of this gene is induced in response to mitogenic stimulation and this netrin domain-containing protein is localized to the ECM. Mutations in this gene have been associated with the autosomal dominant disorder Sorsby's fundus dystrophy. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.