Human TIMP3/HSMRK222/ K222 ORF/cDNA clone-Lentivirus particle (NM_000362)

Pre-made Human TIMP3/HSMRK222/ K222 Lentiviral expression plasmid for TIMP3 lentivirus packaging, TIMP3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to TIMP3/HSMRK222 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000407 Human TIMP3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000407
Gene Name TIMP3
Accession Number NM_000362
Gene ID 7078
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 636 bp
Gene Alias HSMRK222, K222, K222TA2, SFD
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACCCCTTGGCTCGGGCTCATCGTGCTCCTGGGCAGCTGGAGCCTGGGGGACTGGGGCGCCGAGGCGTGCACATGCTCGCCCAGCCACCCCCAGGACGCCTTCTGCAACTCCGACATCGTGATCCGGGCCAAGGTGGTGGGGAAGAAGCTGGTAAAGGAGGGGCCCTTCGGCACGCTGGTCTACACCATCAAGCAGATGAAGATGTACCGAGGCTTCACCAAGATGCCCCATGTGCAGTACATCCATACGGAAGCTTCCGAGAGTCTCTGTGGCCTTAAGCTGGAGGTCAACAAGTACCAGTACCTGCTGACAGGTCGCGTCTATGATGGCAAGATGTACACGGGGCTGTGCAACTTCGTGGAGAGGTGGGACCAGCTCACCCTCTCCCAGCGCAAGGGGCTGAACTATCGGTATCACCTGGGTTGTAACTGCAAGATCAAGTCCTGCTACTACCTGCCTTGCTTTGTGACTTCCAAGAACGAGTGTCTCTGGACCGACATGCTCTCCAATTTCGGTTACCCTGGCTACCAGTCCAAACACTACGCCTGCATCCGGCAGAAGGGCGGCTACTGCAGCTGGTACCGAGGATGGGCCCCCCCGGATAAAAGCATCATCAATGCCACAGACCCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1339-Ab Anti-TIMP3/ HSMRK222/ K222 functional antibody
    Target Antigen GM-Tg-g-SE1339-Ag TIMP3 protein
    ORF Viral Vector pGMPC000772 Human TIMP3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP000407 Human TIMP3 Lentivirus plasmid
    ORF Viral Vector pGMAP000031 Human TIMP3 Adenovirus plasmid
    ORF Viral Vector vGMLP000407 Human TIMP3 Lentivirus particle
    ORF Viral Vector vGMAP000031 Human TIMP3 Adenovirus particle


    Target information

    Target ID GM-SE1339
    Target Name TIMP3
    Gene ID 7078, 21859, 574381, 25358, 101091215, 481289, 282094, 100033947
    Gene Symbol and Synonyms HSMRK222,K222,K222TA2,SFD,Timp-3,TIMP3
    Uniprot Accession P35625
    Uniprot Entry Name TIMP3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Juvenile astrocytoma
    Gene Ensembl ENSG00000100234
    Target Classification Not Available

    This gene belongs to the TIMP gene family. The proteins encoded by this gene family are inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix (ECM). Expression of this gene is induced in response to mitogenic stimulation and this netrin domain-containing protein is localized to the ECM. Mutations in this gene have been associated with the autosomal dominant disorder Sorsby's fundus dystrophy. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.