Human TIMP3/HSMRK222/ K222 ORF/cDNA clone-Adenovirus particle (BC014277)

Pre-made Human TIMP3/HSMRK222/ K222 Adenovirus for TIMP3 overexpression in-vitro and in-vivo. The TIMP3 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TIMP3-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to TIMP3/HSMRK222 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000031 Human TIMP3 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000031
Gene Name TIMP3
Accession Number BC014277
Gene ID 7078
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 636 bp
Gene Alias HSMRK222, K222, K222TA2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACCCCTTGGCTCGGGCTCATCGTGCTCCTGGGCAGCTGGAGCCTGGGGGACTGGGGCGCCGAGGCGTGCACATGCTCGCCCAGCCACCCCCAGGACGCCTTCTGCAACTCCGACATCGTGATCCGGGCCAAGGTGGTGGGGAAGAAGCTGGTAAAGGAGGGGCCCTTCGGCACGCTGGTCTACACCATCAAGCAGATGAAGATGTACCGAGGCTTCACCAAGATGCCCCATGTGCAGTACATCCATACGGAAGCTTCCGAGAGTCTCTGTGGCCTTAAGCTGGAGGTCAACAAGTACCAGTACCTGCTGACAGGTCGCGTCTATGATGGCAAGATGTACACGGGGCTGTGCAACTTCGTGGAGAGGTGGGACCAGCTCACCCTCTCCCAGCGCAAGGGGCTGAACTATCGGTATCACCTGGGTTGTAACTGCAAGATCAAGTCCTGCTACTACCTGCCTTGCTTTGTGACTTCCAAGAACGAGTGTCTCTGGACCGACATGCTCTCCAATTTCGGTTACCCTGGCTACCAGTCCAAACACTACGCCTGCATCCGGCAGAAGGGCGGCTACTGCAGCTGGTACCGAGGATGGGCCCCCCCGGATAAAAGCATCATCAATGCCACAGACCCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1339-Ab Anti-TIMP3/ HSMRK222/ K222 functional antibody
    Target Antigen GM-Tg-g-SE1339-Ag TIMP3 protein
    ORF Viral Vector pGMPC000772 Human TIMP3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP000407 Human TIMP3 Lentivirus plasmid
    ORF Viral Vector pGMAP000031 Human TIMP3 Adenovirus plasmid
    ORF Viral Vector vGMLP000407 Human TIMP3 Lentivirus particle
    ORF Viral Vector vGMAP000031 Human TIMP3 Adenovirus particle


    Target information

    Target ID GM-SE1339
    Target Name TIMP3
    Gene ID 7078, 21859, 574381, 25358, 101091215, 481289, 282094, 100033947
    Gene Symbol and Synonyms HSMRK222,K222,K222TA2,SFD,Timp-3,TIMP3
    Uniprot Accession P35625
    Uniprot Entry Name TIMP3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Juvenile astrocytoma
    Gene Ensembl ENSG00000100234
    Target Classification Not Available

    This gene belongs to the TIMP gene family. The proteins encoded by this gene family are inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix (ECM). Expression of this gene is induced in response to mitogenic stimulation and this netrin domain-containing protein is localized to the ECM. Mutations in this gene have been associated with the autosomal dominant disorder Sorsby's fundus dystrophy. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.