Human MSRA/PMSR ORF/cDNA clone-Lentivirus plasmid (NM_012331)
Pre-made Human MSRA/PMSR Lentiviral expression plasmid for MSRA lentivirus packaging, MSRA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to MSRA/PMSR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000029 | Human MSRA Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000029 |
Gene Name | MSRA |
Accession Number | NM_012331 |
Gene ID | 4482 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 708 bp |
Gene Alias | PMSR |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTCTCGGCCACCCGGAGGGCTTGCCAGCTCCTCCTCCTCCACAGCCTCTTTCCCGTCCCGAGGATGGGCAACTCGGCCTCGAACATCGTCAGCCCCCAGGAGGCCTTGCCGGGCCGGAAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGGAAATTCTGGGTCTTGAAAGGAGTGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACTTCAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACACATGAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGCCATCTACCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGAGAACTACCAAAAGGTTCTTTCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACAGACTTTCTACTATGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCAATGGCTACTGCGGCCTTGGGGGCACCGGCGTGTCCTGCCCAGTGGGTATTAAAAAATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2600-Ab | Anti-MSRA/ PMSR monoclonal antibody |
Target Antigen | GM-Tg-g-MP2600-Ag | MSRA VLP (virus-like particle) |
ORF Viral Vector | pGMLP000029 | Human MSRA Lentivirus plasmid |
ORF Viral Vector | vGMLP000029 | Human MSRA Lentivirus particle |
Target information
Target ID | GM-MP2600 |
Target Name | MSRA |
Gene ID | 4482, 110265, 698628, 29447, 101082232, 608103, 281312, 100061773 |
Gene Symbol and Synonyms | 2310045J23Rik,6530413P12Rik,MSR-A,MSRA,PMSR |
Uniprot Accession | Q9UJ68 |
Uniprot Entry Name | MSRA_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000175806 |
Target Classification | Not Available |
This gene encodes a ubiquitous and highly conserved protein that carries out the enzymatic reduction of methionine sulfoxide to methionine. Human and animal studies have shown the highest levels of expression in kidney and nervous tissue. The protein functions in the repair of oxidatively damaged proteins to restore biological activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.