Human MSRA/PMSR ORF/cDNA clone-Lentivirus particle (NM_012331)

Pre-made Human MSRA/PMSR Lentiviral expression plasmid for MSRA lentivirus packaging, MSRA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to MSRA/PMSR products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000029 Human MSRA Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000029
Gene Name MSRA
Accession Number NM_012331
Gene ID 4482
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 708 bp
Gene Alias PMSR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTCTCGGCCACCCGGAGGGCTTGCCAGCTCCTCCTCCTCCACAGCCTCTTTCCCGTCCCGAGGATGGGCAACTCGGCCTCGAACATCGTCAGCCCCCAGGAGGCCTTGCCGGGCCGGAAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGGAAATTCTGGGTCTTGAAAGGAGTGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACTTCAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACACATGAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGCCATCTACCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGAGAACTACCAAAAGGTTCTTTCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACAGACTTTCTACTATGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCAATGGCTACTGCGGCCTTGGGGGCACCGGCGTGTCCTGCCCAGTGGGTATTAAAAAATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2600-Ab Anti-MSRA/ PMSR monoclonal antibody
    Target Antigen GM-Tg-g-MP2600-Ag MSRA VLP (virus-like particle)
    ORF Viral Vector pGMLP000029 Human MSRA Lentivirus plasmid
    ORF Viral Vector vGMLP000029 Human MSRA Lentivirus particle


    Target information

    Target ID GM-MP2600
    Target Name MSRA
    Gene ID 4482, 110265, 698628, 29447, 101082232, 608103, 281312, 100061773
    Gene Symbol and Synonyms 2310045J23Rik,6530413P12Rik,MSR-A,MSRA,PMSR
    Uniprot Accession Q9UJ68
    Uniprot Entry Name MSRA_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Prostate Cancer
    Gene Ensembl ENSG00000175806
    Target Classification Not Available

    This gene encodes a ubiquitous and highly conserved protein that carries out the enzymatic reduction of methionine sulfoxide to methionine. Human and animal studies have shown the highest levels of expression in kidney and nervous tissue. The protein functions in the repair of oxidatively damaged proteins to restore biological activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.