Human IL1RN/ICIL-1RA/ IL-1ra3 ORF/cDNA clone-Lentivirus plasmid (BC009745)

Pre-made Human IL1RN/ICIL-1RA/ IL-1ra3 Lentiviral expression plasmid for IL1RN lentivirus packaging, IL1RN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to IL1RN/ICIL-1RA products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000397 Human IL1RN Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000397
Gene Name IL1RN
Accession Number BC009745
Gene ID 3557
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 480 bp
Gene Alias ICIL-1RA, IL-1ra3, IL1F3, IL1RA, IRAP, MGC10430
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTTTAGAGACGATCTGCCGACCCTCTGGGAGAAAATCCAGCAAGATGCAAGCCTTCAGAATCTGGGATGTTAACCAGAAGACCTTCTATCTGAGGAACAACCAACTAGTTGCCGGATACTTGCAAGGACCAAATGTCAATTTAGAAGAAAAGATAGATGTGGTACCCATTGAGCCTCATGCTCTGTTCTTGGGAATCCATGGAGGGAAGATGTGCCTGTCCTGTGTCAAGTCTGGTGATGAGACCAGACTCCAGCTGGAGGCAGTTAACATCACTGACCTGAGCGAGAACAGAAAGCAGGACAAGCGCTTCGCCTTCATCCGCTCAGACAGTGGCCCCACCACCAGTTTTGAGTCTGCCGCCTGCCCCGGTTGGTTCCTCTGCACAGCGATGGAAGCTGACCAGCCCGTCAGCCTCACCAATATGCCTGACGAAGGCGTCATGGTCACCAAATTCTACTTCCAGGAGGACGAGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2544-Ab Anti-IL1RA/ IL1RN/ DIRA monoclonal antibody
    Target Antigen GM-Tg-g-MP2544-Ag IL1RN VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP2544 interleukin 1 receptor antagonist (IL1RN) protein & antibody
    ORF Viral Vector pGMLP000397 Human IL1RN Lentivirus plasmid
    ORF Viral Vector pGMAP000045 Human IL1RN Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-004 Human IL1RN Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-087 Human IL1RN Adenovirus plasmid
    ORF Viral Vector vGMLP000397 Human IL1RN Lentivirus particle
    ORF Viral Vector vGMAP000045 Human IL1RN Adenovirus particle
    ORF Viral Vector vGMLP-IL-004 Human IL1RN Lentivirus particle
    ORF Viral Vector vGMAP-IL-087 Human IL1RN Adenovirus particle


    Target information

    Target ID GM-MP2544
    Target Name IL1RN
    Gene ID 3557, 16181, 701658, 60582, 403660, 281860, 100034236
    Gene Symbol and Synonyms DIRA,F630041P17Rik,ICIL-1RA,IL-1ra,IL-1ra3,IL-1RN,IL1F3,IL1RA,IL1RN,IRAP,MVCD4
    Uniprot Accession P18510
    Uniprot Entry Name IL1RA_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000136689
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses, particularly in the acute phase of infection and inflammation. This gene and five other closely related cytokine genes form a gene cluster spanning approximately 400 kb on chromosome 2. A polymorphism of this gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.