Human IL1RN/ICIL-1RA/ IL-1ra3 ORF/cDNA clone-Adenovirus particle (BC009745)
Pre-made Human IL1RN/ICIL-1RA/ IL-1ra3 Adenovirus for IL1RN overexpression in-vitro and in-vivo. The IL1RN adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IL1RN-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to IL1RN/ICIL-1RA products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000045 | Human IL1RN Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000045 |
Gene Name | IL1RN |
Accession Number | BC009745 |
Gene ID | 3557 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 480 bp |
Gene Alias | ICIL-1RA, IL-1ra3, IL1F3, IL1RA, IRAP, MGC10430 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTTTAGAGACGATCTGCCGACCCTCTGGGAGAAAATCCAGCAAGATGCAAGCCTTCAGAATCTGGGATGTTAACCAGAAGACCTTCTATCTGAGGAACAACCAACTAGTTGCCGGATACTTGCAAGGACCAAATGTCAATTTAGAAGAAAAGATAGATGTGGTACCCATTGAGCCTCATGCTCTGTTCTTGGGAATCCATGGAGGGAAGATGTGCCTGTCCTGTGTCAAGTCTGGTGATGAGACCAGACTCCAGCTGGAGGCAGTTAACATCACTGACCTGAGCGAGAACAGAAAGCAGGACAAGCGCTTCGCCTTCATCCGCTCAGACAGTGGCCCCACCACCAGTTTTGAGTCTGCCGCCTGCCCCGGTTGGTTCCTCTGCACAGCGATGGAAGCTGACCAGCCCGTCAGCCTCACCAATATGCCTGACGAAGGCGTCATGGTCACCAAATTCTACTTCCAGGAGGACGAGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2544-Ab | Anti-IL1RA/ IL1RN/ DIRA monoclonal antibody |
Target Antigen | GM-Tg-g-MP2544-Ag | IL1RN VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-MP2544 | interleukin 1 receptor antagonist (IL1RN) protein & antibody |
ORF Viral Vector | pGMLP000397 | Human IL1RN Lentivirus plasmid |
ORF Viral Vector | pGMAP000045 | Human IL1RN Adenovirus plasmid |
ORF Viral Vector | pGMLP-IL-004 | Human IL1RN Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-087 | Human IL1RN Adenovirus plasmid |
ORF Viral Vector | vGMLP000397 | Human IL1RN Lentivirus particle |
ORF Viral Vector | vGMAP000045 | Human IL1RN Adenovirus particle |
ORF Viral Vector | vGMLP-IL-004 | Human IL1RN Lentivirus particle |
ORF Viral Vector | vGMAP-IL-087 | Human IL1RN Adenovirus particle |
Target information
Target ID | GM-MP2544 |
Target Name | IL1RN |
Gene ID | 3557, 16181, 701658, 60582, 403660, 281860, 100034236 |
Gene Symbol and Synonyms | DIRA,F630041P17Rik,ICIL-1RA,IL-1ra,IL-1ra3,IL-1RN,IL1F3,IL1RA,IL1RN,IRAP,MVCD4 |
Uniprot Accession | P18510 |
Uniprot Entry Name | IL1RA_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000136689 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses, particularly in the acute phase of infection and inflammation. This gene and five other closely related cytokine genes form a gene cluster spanning approximately 400 kb on chromosome 2. A polymorphism of this gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Aug 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.