Human AMBP/A1M/EDC1 ORF/cDNA clone-Lentivirus plasmid (NM_001633)

Cat. No.: pGMLP000555
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human AMBP/A1M/EDC1 Lentiviral expression plasmid for AMBP lentivirus packaging, AMBP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to AMBP/A1M products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $596.52
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000555
Gene Name AMBP
Accession Number NM_001633
Gene ID 259
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1059 bp
Gene Alias A1M,EDC1,HCP,HI30,IATIL,ITI,ITIL,ITILC,UTI
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGAGCCTCGGGGCCCTGCTCTTGCTGCTGAGCGCCTGCCTGGCGGTGAGCGCTGGCCCTGTGCCAACGCCGCCCGACAACATCCAAGTGCAGGAAAACTTCAATATCTCTCGGATCTATGGGAAGTGGTACAACCTGGCCATCGGTTCCACCTGCCCCTGGCTGAAGAAGATCATGGACAGGATGACAGTGAGCACGCTGGTGCTGGGAGAGGGCGCTACAGAGGCGGAGATCAGCATGACCAGCACTCGTTGGCGGAAAGGTGTCTGTGAGGAGACGTCTGGAGCTTATGAGAAAACAGATACTGATGGGAAGTTTCTCTATCACAAATCCAAATGGAACATAACCATGGAGTCCTATGTGGTCCACACCAACTATGATGAGTATGCCATTTTCCTGACCAAGAAATTCAGCCGCCATCATGGACCCACCATTACTGCCAAGCTCTACGGGCGGGCGCCGCAGCTGAGGGAAACTCTCCTGCAGGACTTCAGAGTGGTTGCCCAGGGTGTGGGCATCCCTGAGGACTCCATCTTCACCATGGCTGACCGAGGTGAATGTGTCCCTGGGGAGCAGGAACCAGAGCCCATCTTAATCCCGAGAGTCCGGAGGGCTGTGCTACCCCAAGAAGAGGAAGGATCAGGGGGTGGGCAACTGGTAACTGAAGTCACCAAGAAAGAAGATTCCTGCCAGCTGGGCTACTCGGCCGGTCCCTGCATGGGAATGACCAGCAGGTATTTCTATAATGGTACATCCATGGCCTGTGAGACTTTCCAGTACGGCGGCTGCATGGGCAACGGTAACAACTTCGTCACAGAAAAGGAGTGTCTGCAGACCTGCCGAACTGTGGCGGCCTGCAATCTCCCCATAGTCCGGGGCCCCTGCCGAGCCTTCATCCAGCTCTGGGCATTTGATGCTGTCAAGGGGAAGTGCGTCCTCTTCCCCTACGGGGGCTGCCAGGGCAACGGGAACAAGTTCTACTCAGAGAAGGAGTGCAGAGAGTACTGCGGTGTCCCTGGTGATGGTGATGAGGAGCTGCTGCGCTTCTCCAACTGA
ORF Protein Sequence MRSLGALLLLLSACLAVSAGPVPTPPDNIQVQENFNISRIYGKWYNLAIGSTCPWLKKIMDRMTVSTLVLGEGATEAEISMTSTRWRKGVCEETSGAYEKTDTDGKFLYHKSKWNITMESYVVHTNYDEYAIFLTKKFSRHHGPTITAKLYGRAPQLRETLLQDFRVVAQGVGIPEDSIFTMADRGECVPGEQEPEPILIPRVRRAVLPQEEEGSGGGQLVTEVTKKEDSCQLGYSAGPCMGMTSRYFYNGTSMACETFQYGGCMGNGNNFVTEKECLQTCRTVAACNLPIVRGPCRAFIQLWAFDAVKGKCVLFPYGGCQGNGNKFYSEKECREYCGVPGDGDEELLRFSN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0055-Ab Anti-AMBP/ A1M/ EDC1 monoclonal antibody
    Target Antigen GM-Tg-g-MP0055-Ag AMBP VLP (virus-like particle)
    ORF Viral Vector pGMLP000555 Human AMBP Lentivirus plasmid
    ORF Viral Vector pGMAP000514 Human AMBP Adenovirus plasmid
    ORF Viral Vector vGMLP000555 Human AMBP Lentivirus particle
    ORF Viral Vector vGMAP000514 Human AMBP Adenovirus particle


    Target information

    Target ID GM-MP0055
    Target Name AMBP
    Gene ID 259, 11699, 704425, 25377, 100510797, 481685, 280996, 100051766
    Gene Symbol and Synonyms A1M,AMBP,ASPI,EDC1,HCP,HI-30,HI30,IATIL,Intin4,ITI,ITIL,ITILC,UTI
    Uniprot Accession P02760
    Uniprot Entry Name AMBP_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Diagnostics Biomarker
    Disease Ovary Cancer, Acute kidney failure, Complications of kidney transplant, Congenital occlusion of ureteropelvic junction, Contrast - Induced Nephropathy, Diabetic Nephropathy, IgA glomerulonephritis, Malignant neoplasm of bladder, Nephrotic syndrome with focal and segmental glomerular lesions, Other diseases of intestines (K55-K64), Type 1 diabetes mellitus, Type 2 diabetes mellitus, Type 2 diabetes mellitus with diabetic nephropathy, Balkan nephropathy
    Gene Ensembl ENSG00000106927
    Target Classification Not Available

    This gene encodes a complex glycoprotein secreted in plasma. The precursor is proteolytically processed into distinct functioning proteins: alpha-1-microglobulin, which belongs to the superfamily of lipocalin transport proteins and may play a role in the regulation of inflammatory processes, and bikunin, which is a urinary trypsin inhibitor belonging to the superfamily of Kunitz-type protease inhibitors and plays an important role in many physiological and pathological processes. This gene is located on chromosome 9 in a cluster of lipocalin genes. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.