Human AMBP/A1M/ EDC1 ORF/cDNA clone-Lentivirus particle (NM_001633)
Pre-made Human AMBP/A1M/ EDC1 Lentiviral expression plasmid for AMBP lentivirus packaging, AMBP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to AMBP/A1M products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000555 | Human AMBP Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000555 |
Gene Name | AMBP |
Accession Number | NM_001633 |
Gene ID | 259 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1059 bp |
Gene Alias | A1M, EDC1, HCP, HI30, IATIL, ITI, ITIL, ITILC, UTI |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGAGCCTCGGGGCCCTGCTCTTGCTGCTGAGCGCCTGCCTGGCGGTGAGCGCTGGCCCTGTGCCAACGCCGCCCGACAACATCCAAGTGCAGGAAAACTTCAATATCTCTCGGATCTATGGGAAGTGGTACAACCTGGCCATCGGTTCCACCTGCCCCTGGCTGAAGAAGATCATGGACAGGATGACAGTGAGCACGCTGGTGCTGGGAGAGGGCGCTACAGAGGCGGAGATCAGCATGACCAGCACTCGTTGGCGGAAAGGTGTCTGTGAGGAGACGTCTGGAGCTTATGAGAAAACAGATACTGATGGGAAGTTTCTCTATCACAAATCCAAATGGAACATAACCATGGAGTCCTATGTGGTCCACACCAACTATGATGAGTATGCCATTTTCCTGACCAAGAAATTCAGCCGCCATCATGGACCCACCATTACTGCCAAGCTCTACGGGCGGGCGCCGCAGCTGAGGGAAACTCTCCTGCAGGACTTCAGAGTGGTTGCCCAGGGTGTGGGCATCCCTGAGGACTCCATCTTCACCATGGCTGACCGAGGTGAATGTGTCCCTGGGGAGCAGGAACCAGAGCCCATCTTAATCCCGAGAGTCCGGAGGGCTGTGCTACCCCAAGAAGAGGAAGGATCAGGGGGTGGGCAACTGGTAACTGAAGTCACCAAGAAAGAAGATTCCTGCCAGCTGGGCTACTCGGCCGGTCCCTGCATGGGAATGACCAGCAGGTATTTCTATAATGGTACATCCATGGCCTGTGAGACTTTCCAGTACGGCGGCTGCATGGGCAACGGTAACAACTTCGTCACAGAAAAGGAGTGTCTGCAGACCTGCCGAACTGTGGCGGCCTGCAATCTCCCCATAGTCCGGGGCCCCTGCCGAGCCTTCATCCAGCTCTGGGCATTTGATGCTGTCAAGGGGAAGTGCGTCCTCTTCCCCTACGGGGGCTGCCAGGGCAACGGGAACAAGTTCTACTCAGAGAAGGAGTGCAGAGAGTACTGCGGTGTCCCTGGTGATGGTGATGAGGAGCTGCTGCGCTTCTCCAACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0055-Ab | Anti-AMBP/ A1M/ EDC1 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0055-Ag | AMBP VLP (virus-like particle) |
ORF Viral Vector | pGMLP000555 | Human AMBP Lentivirus plasmid |
ORF Viral Vector | pGMAP000514 | Human AMBP Adenovirus plasmid |
ORF Viral Vector | vGMLP000555 | Human AMBP Lentivirus particle |
ORF Viral Vector | vGMAP000514 | Human AMBP Adenovirus particle |
Target information
Target ID | GM-MP0055 |
Target Name | AMBP |
Gene ID | 259, 11699, 704425, 25377, 100510797, 481685, 280996, 100051766 |
Gene Symbol and Synonyms | A1M,AMBP,ASPI,EDC1,HCP,HI-30,HI30,IATIL,Intin4,ITI,ITIL,ITILC,UTI |
Uniprot Accession | P02760 |
Uniprot Entry Name | AMBP_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Diagnostics Biomarker |
Disease | Ovary Cancer, Acute kidney failure, Complications of kidney transplant, Congenital occlusion of ureteropelvic junction, Contrast - Induced Nephropathy, Diabetic Nephropathy, IgA glomerulonephritis, Malignant neoplasm of bladder, Nephrotic syndrome with focal and segmental glomerular lesions, Other diseases of intestines (K55-K64), Type 1 diabetes mellitus, Type 2 diabetes mellitus, Type 2 diabetes mellitus with diabetic nephropathy, Balkan nephropathy |
Gene Ensembl | ENSG00000106927 |
Target Classification | Not Available |
This gene encodes a complex glycoprotein secreted in plasma. The precursor is proteolytically processed into distinct functioning proteins: alpha-1-microglobulin, which belongs to the superfamily of lipocalin transport proteins and may play a role in the regulation of inflammatory processes, and bikunin, which is a urinary trypsin inhibitor belonging to the superfamily of Kunitz-type protease inhibitors and plays an important role in many physiological and pathological processes. This gene is located on chromosome 9 in a cluster of lipocalin genes. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.