Human AMBP/HCP/ UTI ORF/cDNA clone-Adenovirus particle (BC041593)
Pre-made Human AMBP/HCP/ UTI Adenovirus for AMBP overexpression in-vitro and in-vivo. The AMBP adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified AMBP-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to AMBP/HCP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000514 | Human AMBP Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000514 |
Gene Name | AMBP |
Accession Number | BC041593 |
Gene ID | 259 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1059 bp |
Gene Alias | HCP, UTI |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGAGCCTCGGGGCCCTGCTCTTGCTGCTGAGCGCCTGCCTGGCGGTGAGCGCTGGCCCTGTGCCAACGCCGCCCGACAACATCCAAGTGCAGGAAAACTTCAATATCTCTCGGATCTATGGGAAGTGGTACAACCTGGCCATCGGTTCCACCTGCCCCTGGCTGAAGAAGATCATGGACAGGATGACAGTGAGCACGCTGGTGCTGGGAGAGGGCGCTACAGAGGCGGAGATCAGCATGACCAGCACTCGTTGGCGGAAAGGTGTCTGTGAGGAGACGTCTGGAGCTTATGAGAAAACAGATACTGATGGGAAGTTTCTCTATCACAAATCCAAATGGAACATAACCATGGAGTCCTATGTGGTCCACACCAACTATGATGAGTATGCCATTTTCCTGACCAAGAAATTCAGCCGCCATCATGGACCCACCATTACTGCCAAGCTCTACGGGCGGGCGCCGCAGCTGAGGGAAACTCTCCTGCAGGACTTCAGAGTGGTTGCCCAGGGTGTGGGCATCCCTGAGGACTCCATCTTCACCATGGCTGACCGAGGTGAATGTGTCCCTGGGGAGCAGGAACCAGAGCCCATCTTAATCCCGAGAGTCCGGAGGGCTGTGCTACCCCAAGAAGAGGAAGGATCAGGGGGTGGGCAACTGGTAACTGAAGTCACCAAGAAAGAAGATTCCTGCCAGCTGGGCTACTCGGCCGGTCCCTGCATGGGAATGACCAGCAGGTATTTCTATAATGGTACATCCATGGCCTGTGAGACTTTCCAGTACGGCGGCTGCATGGGCAACGGTAACAACTTCGTCACAGAAAAGGAGTGTCTGCAGACCTGCCGAACTGTGGCGGCCTGCAATCTCCCCATAGTCCGGGGCCCCTGCCGAGCCTTCATCCAGCTCTGGGCATTTGATGCTGTCAAGGGGAAGTGCGTCCTCTTCCCCTACGGGGGCTGCCAGGGCAACGGGAACAAGTTCTACTCAGAGAAGGAGTGCAGAGAGTACTGCGGTGTCCCTGGTGATGGTGATGAGGAGCTGCTGCGCTTCTCCAACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0055-Ab | Anti-AMBP/ A1M/ EDC1 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0055-Ag | AMBP VLP (virus-like particle) |
ORF Viral Vector | pGMLP000555 | Human AMBP Lentivirus plasmid |
ORF Viral Vector | pGMAP000514 | Human AMBP Adenovirus plasmid |
ORF Viral Vector | vGMLP000555 | Human AMBP Lentivirus particle |
ORF Viral Vector | vGMAP000514 | Human AMBP Adenovirus particle |
Target information
Target ID | GM-MP0055 |
Target Name | AMBP |
Gene ID | 259, 11699, 704425, 25377, 100510797, 481685, 280996, 100051766 |
Gene Symbol and Synonyms | A1M,AMBP,ASPI,EDC1,HCP,HI-30,HI30,IATIL,Intin4,ITI,ITIL,ITILC,UTI |
Uniprot Accession | P02760 |
Uniprot Entry Name | AMBP_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Diagnostics Biomarker |
Disease | Ovary Cancer, Acute kidney failure, Complications of kidney transplant, Congenital occlusion of ureteropelvic junction, Contrast - Induced Nephropathy, Diabetic Nephropathy, IgA glomerulonephritis, Malignant neoplasm of bladder, Nephrotic syndrome with focal and segmental glomerular lesions, Other diseases of intestines (K55-K64), Type 1 diabetes mellitus, Type 2 diabetes mellitus, Type 2 diabetes mellitus with diabetic nephropathy, Balkan nephropathy |
Gene Ensembl | ENSG00000106927 |
Target Classification | Not Available |
This gene encodes a complex glycoprotein secreted in plasma. The precursor is proteolytically processed into distinct functioning proteins: alpha-1-microglobulin, which belongs to the superfamily of lipocalin transport proteins and may play a role in the regulation of inflammatory processes, and bikunin, which is a urinary trypsin inhibitor belonging to the superfamily of Kunitz-type protease inhibitors and plays an important role in many physiological and pathological processes. This gene is located on chromosome 9 in a cluster of lipocalin genes. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.