Human AMBP/HCP/UTI ORF/cDNA clone-Adenovirus particle (BC041593)

Cat. No.: vGMAP000514

Pre-made Human AMBP/HCP/UTI Adenovirus for AMBP overexpression in-vitro and in-vivo. The AMBP adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified AMBP-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to AMBP/HCP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000514 Human AMBP Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000514
Gene Name AMBP
Accession Number BC041593
Gene ID 259
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1059 bp
Gene Alias HCP,UTI
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGAGCCTCGGGGCCCTGCTCTTGCTGCTGAGCGCCTGCCTGGCGGTGAGCGCTGGCCCTGTGCCAACGCCGCCCGACAACATCCAAGTGCAGGAAAACTTCAATATCTCTCGGATCTATGGGAAGTGGTACAACCTGGCCATCGGTTCCACCTGCCCCTGGCTGAAGAAGATCATGGACAGGATGACAGTGAGCACGCTGGTGCTGGGAGAGGGCGCTACAGAGGCGGAGATCAGCATGACCAGCACTCGTTGGCGGAAAGGTGTCTGTGAGGAGACGTCTGGAGCTTATGAGAAAACAGATACTGATGGGAAGTTTCTCTATCACAAATCCAAATGGAACATAACCATGGAGTCCTATGTGGTCCACACCAACTATGATGAGTATGCCATTTTCCTGACCAAGAAATTCAGCCGCCATCATGGACCCACCATTACTGCCAAGCTCTACGGGCGGGCGCCGCAGCTGAGGGAAACTCTCCTGCAGGACTTCAGAGTGGTTGCCCAGGGTGTGGGCATCCCTGAGGACTCCATCTTCACCATGGCTGACCGAGGTGAATGTGTCCCTGGGGAGCAGGAACCAGAGCCCATCTTAATCCCGAGAGTCCGGAGGGCTGTGCTACCCCAAGAAGAGGAAGGATCAGGGGGTGGGCAACTGGTAACTGAAGTCACCAAGAAAGAAGATTCCTGCCAGCTGGGCTACTCGGCCGGTCCCTGCATGGGAATGACCAGCAGGTATTTCTATAATGGTACATCCATGGCCTGTGAGACTTTCCAGTACGGCGGCTGCATGGGCAACGGTAACAACTTCGTCACAGAAAAGGAGTGTCTGCAGACCTGCCGAACTGTGGCGGCCTGCAATCTCCCCATAGTCCGGGGCCCCTGCCGAGCCTTCATCCAGCTCTGGGCATTTGATGCTGTCAAGGGGAAGTGCGTCCTCTTCCCCTACGGGGGCTGCCAGGGCAACGGGAACAAGTTCTACTCAGAGAAGGAGTGCAGAGAGTACTGCGGTGTCCCTGGTGATGGTGATGAGGAGCTGCTGCGCTTCTCCAACTGA
ORF Protein Sequence MRSLGALLLLLSACLAVSAGPVPTPPDNIQVQENFNISRIYGKWYNLAIGSTCPWLKKIMDRMTVSTLVLGEGATEAEISMTSTRWRKGVCEETSGAYEKTDTDGKFLYHKSKWNITMESYVVHTNYDEYAIFLTKKFSRHHGPTITAKLYGRAPQLRETLLQDFRVVAQGVGIPEDSIFTMADRGECVPGEQEPEPILIPRVRRAVLPQEEEGSGGGQLVTEVTKKEDSCQLGYSAGPCMGMTSRYFYNGTSMACETFQYGGCMGNGNNFVTEKECLQTCRTVAACNLPIVRGPCRAFIQLWAFDAVKGKCVLFPYGGCQGNGNKFYSEKECREYCGVPGDGDEELLRFSN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0055-Ab Anti-AMBP/ A1M/ EDC1 monoclonal antibody
    Target Antigen GM-Tg-g-MP0055-Ag AMBP VLP (virus-like particle)
    ORF Viral Vector pGMLP000555 Human AMBP Lentivirus plasmid
    ORF Viral Vector pGMAP000514 Human AMBP Adenovirus plasmid
    ORF Viral Vector vGMLP000555 Human AMBP Lentivirus particle
    ORF Viral Vector vGMAP000514 Human AMBP Adenovirus particle


    Target information

    Target ID GM-MP0055
    Target Name AMBP
    Gene ID 259, 11699, 704425, 25377, 100510797, 481685, 280996, 100051766
    Gene Symbol and Synonyms A1M,AMBP,ASPI,EDC1,HCP,HI-30,HI30,IATIL,Intin4,ITI,ITIL,ITILC,UTI
    Uniprot Accession P02760
    Uniprot Entry Name AMBP_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Diagnostics Biomarker
    Disease Ovary Cancer, Acute kidney failure, Complications of kidney transplant, Congenital occlusion of ureteropelvic junction, Contrast - Induced Nephropathy, Diabetic Nephropathy, IgA glomerulonephritis, Malignant neoplasm of bladder, Nephrotic syndrome with focal and segmental glomerular lesions, Other diseases of intestines (K55-K64), Type 1 diabetes mellitus, Type 2 diabetes mellitus, Type 2 diabetes mellitus with diabetic nephropathy, Balkan nephropathy
    Gene Ensembl ENSG00000106927
    Target Classification Not Available

    This gene encodes a complex glycoprotein secreted in plasma. The precursor is proteolytically processed into distinct functioning proteins: alpha-1-microglobulin, which belongs to the superfamily of lipocalin transport proteins and may play a role in the regulation of inflammatory processes, and bikunin, which is a urinary trypsin inhibitor belonging to the superfamily of Kunitz-type protease inhibitors and plays an important role in many physiological and pathological processes. This gene is located on chromosome 9 in a cluster of lipocalin genes. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.