Human DHH/GDXYM/HHG-3 ORF/cDNA clone-Lentivirus plasmid (NM_021044)
Cat. No.: pGMLP001485
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human DHH/GDXYM/HHG-3 Lentiviral expression plasmid for DHH lentivirus packaging, DHH lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
DHH/GDXYM products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP001485 |
Gene Name | DHH |
Accession Number | NM_021044 |
Gene ID | 50846 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1191 bp |
Gene Alias | GDXYM,HHG-3,SRXY7 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCTCTCCTGACCAATCTACTGCCCCTGTGCTGCTTGGCACTTCTGGCGCTGCCAGCCCAGAGCTGCGGGCCGGGCCGGGGGCCGGTTGGCCGGCGCCGCTATGCGCGCAAGCAGCTCGTGCCGCTACTCTACAAGCAATTTGTGCCCGGCGTGCCAGAGCGGACCCTGGGCGCCAGTGGGCCAGCGGAGGGGAGGGTGGCAAGGGGCTCCGAGCGCTTCCGGGACCTCGTGCCCAACTACAACCCCGACATCATCTTCAAGGATGAGGAGAACAGTGGAGCCGACCGCCTGATGACCGAGCGTTGTAAGGAGCGGGTGAACGCTTTGGCCATTGCCGTGATGAACATGTGGCCCGGAGTGCGCCTACGAGTGACTGAGGGCTGGGACGAGGACGGCCACCACGCTCAGGATTCACTCCACTACGAAGGCCGTGCTTTGGACATCACTACGTCTGACCGCGACCGCAACAAGTATGGGTTGCTGGCGCGCCTCGCAGTGGAAGCCGGCTTCGACTGGGTCTACTACGAGTCCCGCAACCACGTCCACGTGTCGGTCAAAGCTGATAACTCACTGGCGGTCCGGGCGGGCGGCTGCTTTCCGGGAAATGCAACTGTGCGCCTGTGGAGCGGCGAGCGGAAAGGGCTGCGGGAACTGCACCGCGGAGACTGGGTTTTGGCGGCCGATGCGTCAGGCCGGGTGGTGCCCACGCCGGTGCTGCTCTTCCTGGACCGGGACTTGCAGCGCCGGGCTTCATTTGTGGCTGTGGAGACCGAGTGGCCTCCACGCAAACTGTTGCTCACGCCCTGGCACCTGGTGTTTGCCGCTCGAGGGCCGGCGCCCGCGCCAGGCGACTTTGCACCGGTGTTCGCGCGCCGGCTACGCGCTGGGGACTCGGTGCTGGCGCCCGGCGGGGATGCGCTTCGGCCAGCGCGCGTGGCCCGTGTGGCGCGGGAGGAAGCCGTGGGCGTGTTCGCGCCGCTCACCGCGCACGGGACGCTGCTGGTGAACGATGTCCTGGCCTCTTGCTACGCGGTTCTGGAGAGTCACCAGTGGGCGCACCGCGCTTTTGCCCCCTTGAGACTGCTGCACGCGCTAGGGGCGCTGCTCCCCGGCGGGGCCGTCCAGCCGACTGGCATGCATTGGTACTCTCGGCTCCTCTACCGCTTAGCGGAGGAGCTACTGGGCTGA |
ORF Protein Sequence | MALLTNLLPLCCLALLALPAQSCGPGRGPVGRRRYARKQLVPLLYKQFVPGVPERTLGASGPAEGRVARGSERFRDLVPNYNPDIIFKDEENSGADRLMTERCKERVNALAIAVMNMWPGVRLRVTEGWDEDGHHAQDSLHYEGRALDITTSDRDRNKYGLLARLAVEAGFDWVYYESRNHVHVSVKADNSLAVRAGGCFPGNATVRLWSGERKGLRELHRGDWVLAADASGRVVPTPVLLFLDRDLQRRASFVAVETEWPPRKLLLTPWHLVFAARGPAPAPGDFAPVFARRLRAGDSVLAPGGDALRPARVARVAREEAVGVFAPLTAHGTLLVNDVLASCYAVLESHQWAHRAFAPLRLLHALGALLPGGAVQPTGMHWYSRLLYRLAEELLG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2431-Ab | Anti-DHH/ GDXYM/ HHG-3 monoclonal antibody |
Target Antigen | GM-Tg-g-MP2431-Ag | DHH VLP (virus-like particle) |
ORF Viral Vector | pGMLP001485 | Human DHH Lentivirus plasmid |
ORF Viral Vector | pGMLP-SPh-074 | Human DHH Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-214 | Human DHH Adenovirus plasmid |
ORF Viral Vector | vGMLP001485 | Human DHH Lentivirus particle |
ORF Viral Vector | vGMLP-SPh-074 | Human DHH Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-214 | Human DHH Adenovirus particle |
Target information
Target ID | GM-MP2431 |
Target Name | DHH |
Gene ID | 50846, 13363, 711048, 84380, 101095751, 100685337, 525833, 100059016 |
Gene Symbol and Synonyms | DHH,GDMN,GDXYM,HHG-3,SRXY7 |
Uniprot Accession | O43323 |
Uniprot Entry Name | DHH_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000139549 |
Target Classification | Not Available |
This gene encodes a member of the hedgehog family. The hedgehog gene family encodes signaling molecules that play an important role in regulating morphogenesis. This protein is predicted to be made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the organism. Defects in this protein have been associated with partial gonadal dysgenesis (PGD) accompanied by minifascicular polyneuropathy. This protein may be involved in both male gonadal differentiation and perineurial development. [provided by RefSeq, May 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.