Human DHH/GDXYM/HHG-3 ORF/cDNA clone-Adenovirus particle (NM_021044)
Cat. No.: vGMAP-SPh-214
Pre-made Human DHH/GDXYM/HHG-3 Adenovirus for DHH overexpression in-vitro and in-vivo. The DHH adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified DHH-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
DHH/GDXYM products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP-SPh-214 | Human DHH Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP-SPh-214 |
| Gene Name | DHH |
| Accession Number | NM_021044 |
| Gene ID | 50846 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1191 bp |
| Gene Alias | GDXYM,HHG-3,SRXY7 |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCTCTCCTGACCAATCTACTGCCCCTGTGCTGCTTGGCACTTCTGGCGCTGCCAGCCCAGAGCTGCGGGCCGGGCCGGGGGCCGGTTGGCCGGCGCCGCTATGCGCGCAAGCAGCTCGTGCCGCTACTCTACAAGCAATTTGTGCCCGGCGTGCCAGAGCGGACCCTGGGCGCCAGTGGGCCAGCGGAGGGGAGGGTGGCAAGGGGCTCCGAGCGCTTCCGGGACCTCGTGCCCAACTACAACCCCGACATCATCTTCAAGGATGAGGAGAACAGTGGAGCCGACCGCCTGATGACCGAGCGTTGTAAGGAGCGGGTGAACGCTTTGGCCATTGCCGTGATGAACATGTGGCCCGGAGTGCGCCTACGAGTGACTGAGGGCTGGGACGAGGACGGCCACCACGCTCAGGATTCACTCCACTACGAAGGCCGTGCTTTGGACATCACTACGTCTGACCGCGACCGCAACAAGTATGGGTTGCTGGCGCGCCTCGCAGTGGAAGCCGGCTTCGACTGGGTCTACTACGAGTCCCGCAACCACGTCCACGTGTCGGTCAAAGCTGATAACTCACTGGCGGTCCGGGCGGGCGGCTGCTTTCCGGGAAATGCAACTGTGCGCCTGTGGAGCGGCGAGCGGAAAGGGCTGCGGGAACTGCACCGCGGAGACTGGGTTTTGGCGGCCGATGCGTCAGGCCGGGTGGTGCCCACGCCGGTGCTGCTCTTCCTGGACCGGGACTTGCAGCGCCGGGCTTCATTTGTGGCTGTGGAGACCGAGTGGCCTCCACGCAAACTGTTGCTCACGCCCTGGCACCTGGTGTTTGCCGCTCGAGGGCCGGCGCCCGCGCCAGGCGACTTTGCACCGGTGTTCGCGCGCCGGCTACGCGCTGGGGACTCGGTGCTGGCGCCCGGCGGGGATGCGCTTCGGCCAGCGCGCGTGGCCCGTGTGGCGCGGGAGGAAGCCGTGGGCGTGTTCGCGCCGCTCACCGCGCACGGGACGCTGCTGGTGAACGATGTCCTGGCCTCTTGCTACGCGGTTCTGGAGAGTCACCAGTGGGCGCACCGCGCTTTTGCCCCCTTGAGACTGCTGCACGCGCTAGGGGCGCTGCTCCCCGGCGGGGCCGTCCAGCCGACTGGCATGCATTGGTACTCTCGGCTCCTCTACCGCTTAGCGGAGGAGCTACTGGGCTGA |
| ORF Protein Sequence | MALLTNLLPLCCLALLALPAQSCGPGRGPVGRRRYARKQLVPLLYKQFVPGVPERTLGASGPAEGRVARGSERFRDLVPNYNPDIIFKDEENSGADRLMTERCKERVNALAIAVMNMWPGVRLRVTEGWDEDGHHAQDSLHYEGRALDITTSDRDRNKYGLLARLAVEAGFDWVYYESRNHVHVSVKADNSLAVRAGGCFPGNATVRLWSGERKGLRELHRGDWVLAADASGRVVPTPVLLFLDRDLQRRASFVAVETEWPPRKLLLTPWHLVFAARGPAPAPGDFAPVFARRLRAGDSVLAPGGDALRPARVARVAREEAVGVFAPLTAHGTLLVNDVLASCYAVLESHQWAHRAFAPLRLLHALGALLPGGAVQPTGMHWYSRLLYRLAEELLG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP2431-Ab | Anti-DHH/ GDXYM/ HHG-3 monoclonal antibody |
| Target Antigen | GM-Tg-g-MP2431-Ag | DHH VLP (virus-like particle) |
| ORF Viral Vector | pGMLP001485 | Human DHH Lentivirus plasmid |
| ORF Viral Vector | pGMLP-SPh-074 | Human DHH Lentivirus plasmid |
| ORF Viral Vector | pGMAP-SPh-214 | Human DHH Adenovirus plasmid |
| ORF Viral Vector | vGMLP001485 | Human DHH Lentivirus particle |
| ORF Viral Vector | vGMLP-SPh-074 | Human DHH Lentivirus particle |
| ORF Viral Vector | vGMAP-SPh-214 | Human DHH Adenovirus particle |
Target information
| Target ID | GM-MP2431 |
| Target Name | DHH |
| Gene ID | 50846, 13363, 711048, 84380, 101095751, 100685337, 525833, 100059016 |
| Gene Symbol and Synonyms | DHH,GDMN,GDXYM,HHG-3,SRXY7 |
| Uniprot Accession | O43323 |
| Uniprot Entry Name | DHH_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000139549 |
| Target Classification | Not Available |
This gene encodes a member of the hedgehog family. The hedgehog gene family encodes signaling molecules that play an important role in regulating morphogenesis. This protein is predicted to be made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the organism. Defects in this protein have been associated with partial gonadal dysgenesis (PGD) accompanied by minifascicular polyneuropathy. This protein may be involved in both male gonadal differentiation and perineurial development. [provided by RefSeq, May 2010]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


