Human DHH/GDXYM/HHG-3 ORF/cDNA clone-Adenovirus plasmid (NM_021044)

Cat. No.: pGMAP-SPh-214
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DHH/GDXYM/HHG-3 adenoviral expression plasmid for DHH adenovirus packaging, DHH adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to DHH/GDXYM products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP-SPh-214
Gene Name DHH
Accession Number NM_021044
Gene ID 50846
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1191 bp
Gene Alias GDXYM,HHG-3,SRXY7
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTCTCCTGACCAATCTACTGCCCCTGTGCTGCTTGGCACTTCTGGCGCTGCCAGCCCAGAGCTGCGGGCCGGGCCGGGGGCCGGTTGGCCGGCGCCGCTATGCGCGCAAGCAGCTCGTGCCGCTACTCTACAAGCAATTTGTGCCCGGCGTGCCAGAGCGGACCCTGGGCGCCAGTGGGCCAGCGGAGGGGAGGGTGGCAAGGGGCTCCGAGCGCTTCCGGGACCTCGTGCCCAACTACAACCCCGACATCATCTTCAAGGATGAGGAGAACAGTGGAGCCGACCGCCTGATGACCGAGCGTTGTAAGGAGCGGGTGAACGCTTTGGCCATTGCCGTGATGAACATGTGGCCCGGAGTGCGCCTACGAGTGACTGAGGGCTGGGACGAGGACGGCCACCACGCTCAGGATTCACTCCACTACGAAGGCCGTGCTTTGGACATCACTACGTCTGACCGCGACCGCAACAAGTATGGGTTGCTGGCGCGCCTCGCAGTGGAAGCCGGCTTCGACTGGGTCTACTACGAGTCCCGCAACCACGTCCACGTGTCGGTCAAAGCTGATAACTCACTGGCGGTCCGGGCGGGCGGCTGCTTTCCGGGAAATGCAACTGTGCGCCTGTGGAGCGGCGAGCGGAAAGGGCTGCGGGAACTGCACCGCGGAGACTGGGTTTTGGCGGCCGATGCGTCAGGCCGGGTGGTGCCCACGCCGGTGCTGCTCTTCCTGGACCGGGACTTGCAGCGCCGGGCTTCATTTGTGGCTGTGGAGACCGAGTGGCCTCCACGCAAACTGTTGCTCACGCCCTGGCACCTGGTGTTTGCCGCTCGAGGGCCGGCGCCCGCGCCAGGCGACTTTGCACCGGTGTTCGCGCGCCGGCTACGCGCTGGGGACTCGGTGCTGGCGCCCGGCGGGGATGCGCTTCGGCCAGCGCGCGTGGCCCGTGTGGCGCGGGAGGAAGCCGTGGGCGTGTTCGCGCCGCTCACCGCGCACGGGACGCTGCTGGTGAACGATGTCCTGGCCTCTTGCTACGCGGTTCTGGAGAGTCACCAGTGGGCGCACCGCGCTTTTGCCCCCTTGAGACTGCTGCACGCGCTAGGGGCGCTGCTCCCCGGCGGGGCCGTCCAGCCGACTGGCATGCATTGGTACTCTCGGCTCCTCTACCGCTTAGCGGAGGAGCTACTGGGCTGA
ORF Protein Sequence MALLTNLLPLCCLALLALPAQSCGPGRGPVGRRRYARKQLVPLLYKQFVPGVPERTLGASGPAEGRVARGSERFRDLVPNYNPDIIFKDEENSGADRLMTERCKERVNALAIAVMNMWPGVRLRVTEGWDEDGHHAQDSLHYEGRALDITTSDRDRNKYGLLARLAVEAGFDWVYYESRNHVHVSVKADNSLAVRAGGCFPGNATVRLWSGERKGLRELHRGDWVLAADASGRVVPTPVLLFLDRDLQRRASFVAVETEWPPRKLLLTPWHLVFAARGPAPAPGDFAPVFARRLRAGDSVLAPGGDALRPARVARVAREEAVGVFAPLTAHGTLLVNDVLASCYAVLESHQWAHRAFAPLRLLHALGALLPGGAVQPTGMHWYSRLLYRLAEELLG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2431-Ab Anti-DHH/ GDXYM/ HHG-3 monoclonal antibody
    Target Antigen GM-Tg-g-MP2431-Ag DHH VLP (virus-like particle)
    ORF Viral Vector pGMLP001485 Human DHH Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-074 Human DHH Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-214 Human DHH Adenovirus plasmid
    ORF Viral Vector vGMLP001485 Human DHH Lentivirus particle
    ORF Viral Vector vGMLP-SPh-074 Human DHH Lentivirus particle
    ORF Viral Vector vGMAP-SPh-214 Human DHH Adenovirus particle


    Target information

    Target ID GM-MP2431
    Target Name DHH
    Gene ID 50846, 13363, 711048, 84380, 101095751, 100685337, 525833, 100059016
    Gene Symbol and Synonyms DHH,GDMN,GDXYM,HHG-3,SRXY7
    Uniprot Accession O43323
    Uniprot Entry Name DHH_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000139549
    Target Classification Not Available

    This gene encodes a member of the hedgehog family. The hedgehog gene family encodes signaling molecules that play an important role in regulating morphogenesis. This protein is predicted to be made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the organism. Defects in this protein have been associated with partial gonadal dysgenesis (PGD) accompanied by minifascicular polyneuropathy. This protein may be involved in both male gonadal differentiation and perineurial development. [provided by RefSeq, May 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.