Human TTR/ATTR/ CTS ORF/cDNA clone-Lentivirus plasmid (NM_000371.3)

Pre-made Human TTR/ATTR/ CTS Lentiviral expression plasmid for TTR lentivirus packaging, TTR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TTR/ATTR products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002013 Human TTR Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002013
Gene Name TTR
Accession Number NM_000371.3
Gene ID 7276
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 444 bp
Gene Alias ATTR, CTS, CTS1, HEL111, HsT2651, PALB, TBPA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTTCTCATCGTCTGCTCCTCCTCTGCCTTGCTGGACTGGTATTTGTGTCTGAGGCTGGCCCTACGGGCACCGGTGAATCCAAGTGTCCTCTGATGGTCAAAGTTCTAGATGCTGTCCGAGGCAGTCCTGCCATCAATGTGGCCGTGCATGTGTTCAGAAAGGCTGCTGATGACACCTGGGAGCCATTTGCCTCTGGGAAAACCAGTGAGTCTGGAGAGCTGCATGGGCTCACAACTGAGGAGGAATTTGTAGAAGGGATATACAAAGTGGAAATAGACACCAAATCTTACTGGAAGGCACTTGGCATCTCCCCATTCCATGAGCATGCAGAGGTGGTATTCACAGCCAACGACTCCGGCCCCCGCCGCTACACCATTGCCGCCCTGCTGAGCCCCTACTCCTATTCCACCACGGCTGTCGTCACCAATCCCAAGGAATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T86462-Ab Anti-TTHY/ TTR/ ATTR functional antibody
    Target Antigen GM-Tg-g-T86462-Ag TTR protein
    ORF Viral Vector pGMLP000332 Human TTR Lentivirus plasmid
    ORF Viral Vector pGMLP002013 Human TTR Lentivirus plasmid
    ORF Viral Vector pGMAP000187 Human TTR Adenovirus plasmid
    ORF Viral Vector vGMLP000332 Human TTR Lentivirus particle
    ORF Viral Vector vGMLP002013 Human TTR Lentivirus particle
    ORF Viral Vector vGMAP000187 Human TTR Adenovirus particle


    Target information

    Target ID GM-T86462
    Target Name TTR
    Gene ID 7276, 22139, 705943, 24856, 101085927, 480167, 280948, 100052147
    Gene Symbol and Synonyms ATTR,CTS,CTS1,HEL111,HsT2651,Lr1,PALB,prealbumin,TBPA,TT,TTN,TTR,TTR1
    Uniprot Accession P02766
    Uniprot Entry Name TTHY_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Ovary Cancer, hepatitis B, ovarian cancer, Ovarian Cancer, Diabetic Nephropathy, Alzheimer's Disease, Choroid plexus tumors, Dent disease, IgA glomerulonephritis, Nephrotic syndrome with focal and segmental glomerular lesions, Type 2 diabetes mellitus
    Gene Ensembl ENSG00000118271
    Target Classification Not Available

    This gene encodes one of the three prealbumins, which include alpha-1-antitrypsin, transthyretin and orosomucoid. The encoded protein, transthyretin, is a homo-tetrameric carrier protein, which transports thyroid hormones in the plasma and cerebrospinal fluid. It is also involved in the transport of retinol (vitamin A) in the plasma by associating with retinol-binding protein. The protein may also be involved in other intracellular processes including proteolysis, nerve regeneration, autophagy and glucose homeostasis. Mutations in this gene are associated with amyloid deposition, predominantly affecting peripheral nerves or the heart, while a small percentage of the gene mutations are non-amyloidogenic. The mutations are implicated in the etiology of several diseases, including amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis and carpal tunnel syndrome. [provided by RefSeq, Aug 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.