Human TTR/HsT2651/ TBPA ORF/cDNA clone-Adenovirus particle (BC005310)
Pre-made Human TTR/HsT2651/ TBPA Adenovirus for TTR overexpression in-vitro and in-vivo. The TTR adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TTR-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to TTR/HsT2651 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000187 | Human TTR Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000187 |
Gene Name | TTR |
Accession Number | BC005310 |
Gene ID | 7276 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 444 bp |
Gene Alias | HsT2651, TBPA |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTTCTCATCGTCTGCTCCTCCTCTGCCTTGCTGGACTGGTATTTGTGTCTGAGGCTGGCCCTACGGGCACCGGTGAATCCAAGTGTCCTCTGATGGTCAAAGTTCTAGATGCTGTCCGAGGCAGTCCTGCCATCAATGTGGCCGTGCATGTGTTCAGAAAGGCTGCTGATGACACCTGGGAGCCATTTGCCTCTGGGAAAACCAGTGAGTCTGGAGAGCTGCATGGGCTCACAACTGAGGAGGAATTTGTAGAAGGGATATACAAAGTGGAAATAGACACCAAATCTTACTGGAAGGCACTTGGCATCTCCCCATTCCATGAGCATGCAGAGGTGGTATTCACAGCCAACGACTCCGGCCCCCGCCGCTACACCATTGCCGCCCTGCTGAGCCCCTACTCCTATTCCACCACGGCTGTCGTCACCAATCCCAAGGAATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T86462-Ab | Anti-TTHY/ TTR/ ATTR functional antibody |
Target Antigen | GM-Tg-g-T86462-Ag | TTR protein |
ORF Viral Vector | pGMLP000332 | Human TTR Lentivirus plasmid |
ORF Viral Vector | pGMLP002013 | Human TTR Lentivirus plasmid |
ORF Viral Vector | pGMAP000187 | Human TTR Adenovirus plasmid |
ORF Viral Vector | vGMLP000332 | Human TTR Lentivirus particle |
ORF Viral Vector | vGMLP002013 | Human TTR Lentivirus particle |
ORF Viral Vector | vGMAP000187 | Human TTR Adenovirus particle |
Target information
Target ID | GM-T86462 |
Target Name | TTR |
Gene ID | 7276, 22139, 705943, 24856, 101085927, 480167, 280948, 100052147 |
Gene Symbol and Synonyms | ATTR,CTS,CTS1,HEL111,HsT2651,Lr1,PALB,prealbumin,TBPA,TT,TTN,TTR,TTR1 |
Uniprot Accession | P02766 |
Uniprot Entry Name | TTHY_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Ovary Cancer, hepatitis B, ovarian cancer, Ovarian Cancer, Diabetic Nephropathy, Alzheimer's Disease, Choroid plexus tumors, Dent disease, IgA glomerulonephritis, Nephrotic syndrome with focal and segmental glomerular lesions, Type 2 diabetes mellitus |
Gene Ensembl | ENSG00000118271 |
Target Classification | Not Available |
This gene encodes one of the three prealbumins, which include alpha-1-antitrypsin, transthyretin and orosomucoid. The encoded protein, transthyretin, is a homo-tetrameric carrier protein, which transports thyroid hormones in the plasma and cerebrospinal fluid. It is also involved in the transport of retinol (vitamin A) in the plasma by associating with retinol-binding protein. The protein may also be involved in other intracellular processes including proteolysis, nerve regeneration, autophagy and glucose homeostasis. Mutations in this gene are associated with amyloid deposition, predominantly affecting peripheral nerves or the heart, while a small percentage of the gene mutations are non-amyloidogenic. The mutations are implicated in the etiology of several diseases, including amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis and carpal tunnel syndrome. [provided by RefSeq, Aug 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.