Human TTR/ATTR/ CTS ORF/cDNA clone-Lentivirus particle (NM_000371.3)
Pre-made Human TTR/ATTR/ CTS Lentiviral expression plasmid for TTR lentivirus packaging, TTR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to TTR/ATTR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002013 | Human TTR Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002013 |
Gene Name | TTR |
Accession Number | NM_000371.3 |
Gene ID | 7276 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 444 bp |
Gene Alias | ATTR, CTS, CTS1, HEL111, HsT2651, PALB, TBPA |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTTCTCATCGTCTGCTCCTCCTCTGCCTTGCTGGACTGGTATTTGTGTCTGAGGCTGGCCCTACGGGCACCGGTGAATCCAAGTGTCCTCTGATGGTCAAAGTTCTAGATGCTGTCCGAGGCAGTCCTGCCATCAATGTGGCCGTGCATGTGTTCAGAAAGGCTGCTGATGACACCTGGGAGCCATTTGCCTCTGGGAAAACCAGTGAGTCTGGAGAGCTGCATGGGCTCACAACTGAGGAGGAATTTGTAGAAGGGATATACAAAGTGGAAATAGACACCAAATCTTACTGGAAGGCACTTGGCATCTCCCCATTCCATGAGCATGCAGAGGTGGTATTCACAGCCAACGACTCCGGCCCCCGCCGCTACACCATTGCCGCCCTGCTGAGCCCCTACTCCTATTCCACCACGGCTGTCGTCACCAATCCCAAGGAATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T86462-Ab | Anti-TTHY/ TTR/ ATTR functional antibody |
Target Antigen | GM-Tg-g-T86462-Ag | TTR protein |
ORF Viral Vector | pGMLP000332 | Human TTR Lentivirus plasmid |
ORF Viral Vector | pGMLP002013 | Human TTR Lentivirus plasmid |
ORF Viral Vector | pGMAP000187 | Human TTR Adenovirus plasmid |
ORF Viral Vector | vGMLP000332 | Human TTR Lentivirus particle |
ORF Viral Vector | vGMLP002013 | Human TTR Lentivirus particle |
ORF Viral Vector | vGMAP000187 | Human TTR Adenovirus particle |
Target information
Target ID | GM-T86462 |
Target Name | TTR |
Gene ID | 7276, 22139, 705943, 24856, 101085927, 480167, 280948, 100052147 |
Gene Symbol and Synonyms | ATTR,CTS,CTS1,HEL111,HsT2651,Lr1,PALB,prealbumin,TBPA,TT,TTN,TTR,TTR1 |
Uniprot Accession | P02766 |
Uniprot Entry Name | TTHY_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Ovary Cancer, hepatitis B, ovarian cancer, Ovarian Cancer, Diabetic Nephropathy, Alzheimer's Disease, Choroid plexus tumors, Dent disease, IgA glomerulonephritis, Nephrotic syndrome with focal and segmental glomerular lesions, Type 2 diabetes mellitus |
Gene Ensembl | ENSG00000118271 |
Target Classification | Not Available |
This gene encodes one of the three prealbumins, which include alpha-1-antitrypsin, transthyretin and orosomucoid. The encoded protein, transthyretin, is a homo-tetrameric carrier protein, which transports thyroid hormones in the plasma and cerebrospinal fluid. It is also involved in the transport of retinol (vitamin A) in the plasma by associating with retinol-binding protein. The protein may also be involved in other intracellular processes including proteolysis, nerve regeneration, autophagy and glucose homeostasis. Mutations in this gene are associated with amyloid deposition, predominantly affecting peripheral nerves or the heart, while a small percentage of the gene mutations are non-amyloidogenic. The mutations are implicated in the etiology of several diseases, including amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis and carpal tunnel syndrome. [provided by RefSeq, Aug 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.