Human ADH1A/ADH1 ORF/cDNA clone-Lentivirus plasmid (NM_000667)
Pre-made Human ADH1A/ADH1 Lentiviral expression plasmid for ADH1A lentivirus packaging, ADH1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to ADH1A/ADH1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002303 | Human ADH1A Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002303 |
Gene Name | ADH1A |
Accession Number | NM_000667 |
Gene ID | 124 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1128 bp |
Gene Alias | ADH1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCACAGCAGGAAAAGTAATCAAATGCAAAGCAGCTGTGCTATGGGAGTTAAAGAAACCCTTTTCCATTGAGGAGGTGGAGGTTGCACCTCCTAAGGCCCATGAAGTTCGTATTAAGATGGTGGCTGTAGGAATCTGTGGCACAGATGACCACGTGGTTAGTGGTACCATGGTGACCCCACTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAGTGTTGGAGAAGGGGTGACTACAGTCAAACCAGGTGATAAAGTCATCCCACTCGCTATTCCTCAGTGTGGAAAATGCAGAATTTGTAAAAACCCGGAGAGCAACTACTGCTTGAAAAACGATGTAAGCAATCCTCAGGGGACCCTGCAGGATGGCACCAGCAGGTTCACCTGCAGGAGGAAGCCCATCCACCACTTCCTTGGCATCAGCACCTTCTCACAGTACACAGTGGTGGATGAAAATGCAGTAGCCAAAATTGATGCAGCCTCGCCTCTAGAGAAAGTCTGTCTCATTGGCTGTGGATTTTCAACTGGTTATGGGTCTGCAGTCAATGTTGCCAAGGTCACCCCAGGCTCTACCTGTGCTGTGTTTGGCCTGGGAGGGGTCGGCCTATCTGCTATTATGGGCTGTAAAGCAGCTGGGGCAGCCAGAATCATTGCGGTGGACATCAACAAGGACAAATTTGCAAAGGCCAAAGAGTTGGGTGCCACTGAATGCATCAACCCTCAAGACTACAAGAAACCCATCCAGGAGGTGCTAAAGGAAATGACTGATGGAGGTGTGGATTTTTCATTTGAAGTCATCGGTCGGCTTGACACCATGATGGCTTCCCTGTTATGTTGTCATGAGGCATGTGGCACAAGTGTCATCGTAGGGGTACCTCCTGATTCCCAAAACCTCTCAATGAACCCTATGCTGCTACTGACTGGACGTACCTGGAAGGGAGCTATTCTTGGTGGCTTTAAAAGTAAAGAATGTGTCCCAAAACTTGTGGCTGATTTTATGGCTAAGAAGTTTTCATTGGATGCATTAATAACCCATGTTTTACCTTTTGAAAAAATAAATGAAGGATTTGACCTGCTTCACTCTGGGAAAAGTATCCGTACCATTCTGATGTTTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T65570-Ab | Anti-ADH1A/ ADH1 monoclonal antibody |
Target Antigen | GM-Tg-g-T65570-Ag | ADH1A VLP (virus-like particle) |
ORF Viral Vector | pGMLP002303 | Human ADH1A Lentivirus plasmid |
ORF Viral Vector | vGMLP002303 | Human ADH1A Lentivirus particle |
Target information
Target ID | GM-T65570 |
Target Name | ADH1A |
Gene ID | 124 |
Gene Symbol and Synonyms | ADH1,ADH1A |
Uniprot Accession | P07327 |
Uniprot Entry Name | ADH1A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000187758 |
Target Classification | Not Available |
This gene encodes a member of the alcohol dehydrogenase family. The encoded protein is the alpha subunit of class I alcohol dehydrogenase, which consists of several homo- and heterodimers of alpha, beta and gamma subunits. Alcohol dehydrogenases catalyze the oxidation of alcohols to aldehydes. This gene is active in the liver in early fetal life but only weakly active in adult liver. This gene is found in a cluster with six additional alcohol dehydrogenase genes, including those encoding the beta and gamma subunits, on the long arm of chromosome 4. Mutations in this gene may contribute to variation in certain personality traits and substance dependence. [provided by RefSeq, Nov 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.