Human ADH1A/ADH1 ORF/cDNA clone-Lentivirus particle (NM_000667)

Pre-made Human ADH1A/ADH1 Lentiviral expression plasmid for ADH1A lentivirus packaging, ADH1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to ADH1A/ADH1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002303 Human ADH1A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002303
Gene Name ADH1A
Accession Number NM_000667
Gene ID 124
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1128 bp
Gene Alias ADH1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCACAGCAGGAAAAGTAATCAAATGCAAAGCAGCTGTGCTATGGGAGTTAAAGAAACCCTTTTCCATTGAGGAGGTGGAGGTTGCACCTCCTAAGGCCCATGAAGTTCGTATTAAGATGGTGGCTGTAGGAATCTGTGGCACAGATGACCACGTGGTTAGTGGTACCATGGTGACCCCACTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAGTGTTGGAGAAGGGGTGACTACAGTCAAACCAGGTGATAAAGTCATCCCACTCGCTATTCCTCAGTGTGGAAAATGCAGAATTTGTAAAAACCCGGAGAGCAACTACTGCTTGAAAAACGATGTAAGCAATCCTCAGGGGACCCTGCAGGATGGCACCAGCAGGTTCACCTGCAGGAGGAAGCCCATCCACCACTTCCTTGGCATCAGCACCTTCTCACAGTACACAGTGGTGGATGAAAATGCAGTAGCCAAAATTGATGCAGCCTCGCCTCTAGAGAAAGTCTGTCTCATTGGCTGTGGATTTTCAACTGGTTATGGGTCTGCAGTCAATGTTGCCAAGGTCACCCCAGGCTCTACCTGTGCTGTGTTTGGCCTGGGAGGGGTCGGCCTATCTGCTATTATGGGCTGTAAAGCAGCTGGGGCAGCCAGAATCATTGCGGTGGACATCAACAAGGACAAATTTGCAAAGGCCAAAGAGTTGGGTGCCACTGAATGCATCAACCCTCAAGACTACAAGAAACCCATCCAGGAGGTGCTAAAGGAAATGACTGATGGAGGTGTGGATTTTTCATTTGAAGTCATCGGTCGGCTTGACACCATGATGGCTTCCCTGTTATGTTGTCATGAGGCATGTGGCACAAGTGTCATCGTAGGGGTACCTCCTGATTCCCAAAACCTCTCAATGAACCCTATGCTGCTACTGACTGGACGTACCTGGAAGGGAGCTATTCTTGGTGGCTTTAAAAGTAAAGAATGTGTCCCAAAACTTGTGGCTGATTTTATGGCTAAGAAGTTTTCATTGGATGCATTAATAACCCATGTTTTACCTTTTGAAAAAATAAATGAAGGATTTGACCTGCTTCACTCTGGGAAAAGTATCCGTACCATTCTGATGTTTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T65570-Ab Anti-ADH1A/ ADH1 monoclonal antibody
    Target Antigen GM-Tg-g-T65570-Ag ADH1A VLP (virus-like particle)
    ORF Viral Vector pGMLP002303 Human ADH1A Lentivirus plasmid
    ORF Viral Vector vGMLP002303 Human ADH1A Lentivirus particle


    Target information

    Target ID GM-T65570
    Target Name ADH1A
    Gene ID 124
    Gene Symbol and Synonyms ADH1,ADH1A
    Uniprot Accession P07327
    Uniprot Entry Name ADH1A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000187758
    Target Classification Not Available

    This gene encodes a member of the alcohol dehydrogenase family. The encoded protein is the alpha subunit of class I alcohol dehydrogenase, which consists of several homo- and heterodimers of alpha, beta and gamma subunits. Alcohol dehydrogenases catalyze the oxidation of alcohols to aldehydes. This gene is active in the liver in early fetal life but only weakly active in adult liver. This gene is found in a cluster with six additional alcohol dehydrogenase genes, including those encoding the beta and gamma subunits, on the long arm of chromosome 4. Mutations in this gene may contribute to variation in certain personality traits and substance dependence. [provided by RefSeq, Nov 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.