Human RSPO1/CRISTIN3/ RSPO ORF/cDNA clone-Lentivirus plasmid (NM_001242908)

Pre-made Human RSPO1/CRISTIN3/ RSPO Lentiviral expression plasmid for RSPO1 lentivirus packaging, RSPO1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to RSPO1/CRISTIN3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003166 Human RSPO1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003166
Gene Name RSPO1
Accession Number NM_001242908
Gene ID 284654
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 792 bp
Gene Alias CRISTIN3, RSPO
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCGGCTTGGGCTGTGTGTGGTGGCCCTGGTTCTGAGCTGGACGCACCTCACCATCAGCAGCCGGGGGATCAAGGGGAAAAGGCAGAGGCGGATCAGTGCCGAGGGGAGCCAGGCCTGTGCCAAAGGCTGTGAGCTCTGCTCTGAAGTCAACGGCTGCCTCAAGTGCTCACCCAAGCTGTTCATCCTGCTGGAGAGGAACGACATCCGCCAGGTGGGCGTCTGCTTGCCGTCCTGCCCACCTGGATACTTCGACGCCCGCAACCCCGACATGAACAAGTGCATCAAATGCAAGATCGAGCACTGTGAGGCCTGCTTCAGCCATAACTTCTGCACCAAGTGTAAGGAGGGCTTGTACCTGCACAAGGGCCGCTGCTATCCAGCTTGTCCCGAGGGCTCCTCAGCTGCCAATGGCACCATGGAGTGCAGTAGTCCTGCGCAATGTGAAATGAGCGAGTGGTCTCCGTGGGGGCCCTGCTCCAAGAAGCAGCAGCTCTGTGGTTTCCGGAGGGGCTCCGAGGAGCGGACACGCAGGGTGCTACATGCCCCTGTGGGGGACCATGCTGCCTGCTCTGACACCAAGGAGACCCGGAGGTGCACAGTGAGGAGAGTGCCGTGTCCTGAGGGGCAGAAGAGGAGGAAGGGAGGCCAGGGCCGGCGGGAGAATGCCAACAGGAACCTGGCCAGGAAGGAGAGCAAGGAGGCGGGTGCTGGCTCTCGAAGACGCAAGGGGCAGCAACAGCAGCAGCAGCAAGGGACAGTGGGGCCACTCACATCTGCAGGGCCTGCCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T91023-Ab Anti-RSPO1/ CRISTIN3/ RSPO functional antibody
    Target Antigen GM-Tg-g-T91023-Ag RSPO1 protein
    ORF Viral Vector pGMAAV000008 Human RSPO1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP003166 Human RSPO1 Lentivirus plasmid
    ORF Viral Vector vGMAAV000008 Human RSPO1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP003166 Human RSPO1 Lentivirus particle


    Target information

    Target ID GM-T91023
    Target Name RSPO1
    Gene ID 284654, 192199, 713976, 313589, 101091033, 608179, 511675, 100054745
    Gene Symbol and Synonyms CRISTIN3,R-spondin,RGD1565558,RSPO,RSPO1,Rspondin
    Uniprot Accession Q2MKA7
    Uniprot Entry Name RSPO1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000169218
    Target Classification Not Available

    This gene encodes a secreted activator protein with two cysteine-rich, furin-like domains and one thrombospondin type 1 domain. The encoded protein is a ligand for leucine-rich repeat-containing G-protein coupled receptors (LGR proteins) and positively regulates the Wnt signaling pathway. In mice, the protein induces the rapid onset of crypt cell proliferation and increases intestinal epithelial healing, providing a protective effect against chemotherapy-induced adverse effects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.