Human RSPO1/CRISTIN3/ RSPO ORF/cDNA clone-Lentivirus particle (NM_001242908)
Pre-made Human RSPO1/CRISTIN3/ RSPO Lentiviral expression plasmid for RSPO1 lentivirus packaging, RSPO1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to RSPO1/CRISTIN3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003166 | Human RSPO1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003166 |
Gene Name | RSPO1 |
Accession Number | NM_001242908 |
Gene ID | 284654 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 792 bp |
Gene Alias | CRISTIN3, RSPO |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCGGCTTGGGCTGTGTGTGGTGGCCCTGGTTCTGAGCTGGACGCACCTCACCATCAGCAGCCGGGGGATCAAGGGGAAAAGGCAGAGGCGGATCAGTGCCGAGGGGAGCCAGGCCTGTGCCAAAGGCTGTGAGCTCTGCTCTGAAGTCAACGGCTGCCTCAAGTGCTCACCCAAGCTGTTCATCCTGCTGGAGAGGAACGACATCCGCCAGGTGGGCGTCTGCTTGCCGTCCTGCCCACCTGGATACTTCGACGCCCGCAACCCCGACATGAACAAGTGCATCAAATGCAAGATCGAGCACTGTGAGGCCTGCTTCAGCCATAACTTCTGCACCAAGTGTAAGGAGGGCTTGTACCTGCACAAGGGCCGCTGCTATCCAGCTTGTCCCGAGGGCTCCTCAGCTGCCAATGGCACCATGGAGTGCAGTAGTCCTGCGCAATGTGAAATGAGCGAGTGGTCTCCGTGGGGGCCCTGCTCCAAGAAGCAGCAGCTCTGTGGTTTCCGGAGGGGCTCCGAGGAGCGGACACGCAGGGTGCTACATGCCCCTGTGGGGGACCATGCTGCCTGCTCTGACACCAAGGAGACCCGGAGGTGCACAGTGAGGAGAGTGCCGTGTCCTGAGGGGCAGAAGAGGAGGAAGGGAGGCCAGGGCCGGCGGGAGAATGCCAACAGGAACCTGGCCAGGAAGGAGAGCAAGGAGGCGGGTGCTGGCTCTCGAAGACGCAAGGGGCAGCAACAGCAGCAGCAGCAAGGGACAGTGGGGCCACTCACATCTGCAGGGCCTGCCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T91023-Ab | Anti-RSPO1/ CRISTIN3/ RSPO functional antibody |
Target Antigen | GM-Tg-g-T91023-Ag | RSPO1 protein |
ORF Viral Vector | pGMAAV000008 | Human RSPO1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP003166 | Human RSPO1 Lentivirus plasmid |
ORF Viral Vector | vGMAAV000008 | Human RSPO1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP003166 | Human RSPO1 Lentivirus particle |
Target information
Target ID | GM-T91023 |
Target Name | RSPO1 |
Gene ID | 284654, 192199, 713976, 313589, 101091033, 608179, 511675, 100054745 |
Gene Symbol and Synonyms | CRISTIN3,R-spondin,RGD1565558,RSPO,RSPO1,Rspondin |
Uniprot Accession | Q2MKA7 |
Uniprot Entry Name | RSPO1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000169218 |
Target Classification | Not Available |
This gene encodes a secreted activator protein with two cysteine-rich, furin-like domains and one thrombospondin type 1 domain. The encoded protein is a ligand for leucine-rich repeat-containing G-protein coupled receptors (LGR proteins) and positively regulates the Wnt signaling pathway. In mice, the protein induces the rapid onset of crypt cell proliferation and increases intestinal epithelial healing, providing a protective effect against chemotherapy-induced adverse effects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.