Human GCGR/GGR/ GL-R ORF/cDNA clone-Lentivirus plasmid (NM_000160)

Pre-made Human GCGR/GGR/ GL-R Lentiviral expression plasmid for GCGR lentivirus packaging, GCGR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to GCGR/GGR products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003748 Human GCGR Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003748
Gene Name GCGR
Accession Number NM_000160
Gene ID 2642
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1434 bp
Gene Alias GGR, GL-R
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCCCCCTGCCAGCCACAGCGACCCCTGCTGCTGTTGCTGCTGCTGCTGGCCTGCCAGCCACAGGTCCCCTCCGCTCAGGTGATGGACTTCCTGTTTGAGAAGTGGAAGCTCTACGGTGACCAGTGTCACCACAACCTGAGCCTGCTGCCCCCTCCCACGGAGCTGGTGTGCAACAGAACCTTCGACAAGTATTCCTGCTGGCCGGACACCCCCGCCAATACCACGGCCAACATCTCCTGCCCCTGGTACCTGCCTTGGCACCACAAAGTGCAACACCGCTTCGTGTTCAAGAGATGCGGGCCCGACGGTCAGTGGGTGCGTGGACCCCGGGGGCAGCCTTGGCGTGATGCCTCCCAGTGCCAGATGGATGGCGAGGAGATTGAGGTCCAGAAGGAGGTGGCCAAGATGTACAGCAGCTTCCAGGTGATGTACACAGTGGGCTACAGCCTGTCCCTGGGGGCCCTGCTCCTCGCCTTGGCCATCCTGGGGGGCCTCAGCAAGCTGCACTGCACCCGCAATGCCATCCACGCGAATCTGTTTGCGTCCTTCGTGCTGAAAGCCAGCTCCGTGCTGGTCATTGATGGGCTGCTCAGGACCCGCTACAGCCAGAAAATTGGCGACGACCTCAGTGTCAGCACCTGGCTCAGTGATGGAGCGGTGGCTGGCTGCCGTGTGGCCGCGGTGTTCATGCAATATGGCATCGTGGCCAACTACTGCTGGCTGCTGGTGGAGGGCCTGTACCTGCACAACCTGCTGGGCCTGGCCACCCTCCCCGAGAGGAGCTTCTTCAGCCTCTACCTGGGCATCGGCTGGGGTGCCCCCATGCTGTTCGTCGTCCCCTGGGCAGTGGTCAAGTGTCTGTTCGAGAACGTCCAGTGCTGGACCAGCAATGACAACATGGGCTTCTGGTGGATCCTGCGGTTCCCCGTCTTCCTGGCCATCCTGATCAACTTCTTCATCTTCGTCCGCATCGTTCAGCTGCTCGTGGCCAAGCTGCGGGCACGGCAGATGCACCACACAGACTACAAGTTCCGGCTGGCCAAGTCCACGCTGACCCTCATCCCTCTGCTGGGCGTCCACGAAGTGGTCTTCGCCTTCGTGACGGACGAGCACGCCCAGGGCACCCTGCGCTCCGCCAAGCTCTTCTTCGACCTCTTCCTCAGCTCCTTCCAGGGCCTGCTGGTGGCTGTCCTCTACTGCTTCCTCAACAAGGAGGTGCAGTCGGAGCTGCGGCGGCGTTGGCACCGCTGGCGCCTGGGCAAAGTGCTATGGGAGGAGCGGAACACCAGCAACCACAGGGCCTCATCTTCGCCCGGCCACGGCCCTCCCAGCAAGGAGCTGCAGTTTGGGAGGGGTGGTGGCAGCCAGGATTCATCTGCGGAGACCCCCTTGGCTGGTGGCCTCCCTAGATTGGCTGAGAGCCCCTTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-124 Pre-Made Crotedumab biosimilar, Whole mAb, Anti-GCGR Antibody: Anti-GGR/GL-R/MVAH therapeutic antibody
    Biosimilar GMP-Bios-INN-857 Pre-Made Glucagon Biosimilar, Recombinant Protein targeting GCGR: Recombinant therapeutic protein targeting GGR/GL-R/MVAH
    Target Antibody GM-Tg-g-T60182-Ab Anti-GLR/ GCGR/ GGR monoclonal antibody
    Target Antigen GM-Tg-g-T60182-Ag GCGR VLP (virus-like particle)
    ORF Viral Vector pGMAAV001254 Human GCGR Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP003748 Human GCGR Lentivirus plasmid
    ORF Viral Vector vGMAAV001254 Human GCGR Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP003748 Human GCGR Lentivirus particle


    Target information

    Target ID GM-T60182
    Target Name GCGR
    Gene ID 2642, 14527, 714542, 24953, 101099672, 483368, 515433, 100055316
    Gene Symbol and Synonyms GCGR,GGR,GL-R,GR,MVAH
    Uniprot Accession P47871
    Uniprot Entry Name GLR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000215644
    Target Classification GPCR

    The protein encoded by this gene is a glucagon receptor that is important in controlling blood glucose levels. Defects in this gene are a cause of non-insulin-dependent diabetes mellitus (NIDDM).[provided by RefSeq, Jan 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.