Human AKT1/AKT/CWS6 ORF/cDNA clone-Lentivirus plasmid (NM_001014431.1)
Cat. No.: pGMLV000429
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human AKT1/AKT/CWS6 Lentiviral expression plasmid for AKT1 lentivirus packaging, AKT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
AKT1/AKT products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLV000429 |
Gene Name | AKT1 |
Accession Number | NM_001014431.1 |
Gene ID | 207 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1443 bp |
Gene Alias | AKT,CWS6,PKB,PKB-ALPHA,PRKBA,RAC,RAC-ALPHA |
Fluorescent Reporter | Null |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAGCGACGTGGCTATTGTGAAGGAGGGTTGGCTGCACAAACGAGGGGAGTACATCAAGACCTGGCGGCCACGCTACTTCCTCCTCAAGAATGATGGCACCTTCATTGGCTACAAGGAGCGGCCGCAGGATGTGGACCAACGTGAGGCTCCCCTCAACAACTTCTCTGTGGCGCAGTGCCAGCTGATGAAGACGGAGCGGCCCCGGCCCAACACCTTCATCATCCGCTGCCTGCAGTGGACCACTGTCATCGAACGCACCTTCCATGTGGAGACTCCTGAGGAGCGGGAGGAGTGGACAACCGCCATCCAGACTGTGGCTGACGGCCTCAAGAAGCAGGAGGAGGAGGAGATGGACTTCCGGTCGGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAGCCCAAGCACCGCGTGACCATGAACGAGTTTGAGTACCTGAAGCTGCTGGGCAAGGGCACTTTCGGCAAGGTGATCCTGGTGAAGGAGAAGGCCACAGGCCGCTACTACGCCATGAAGATCCTCAAGAAGGAAGTCATCGTGGCCAAGGACGAGGTGGCCCACACACTCACCGAGAACCGCGTCCTGCAGAACTCCAGGCACCCCTTCCTCACAGCCCTGAAGTACTCTTTCCAGACCCACGACCGCCTCTGCTTTGTCATGGAGTACGCCAACGGGGGCGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTGTTCTCCGAGGACCGGGCCCGCTTCTATGGCGCTGAGATTGTGTCAGCCCTGGACTACCTGCACTCGGAGAAGAACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTCATGCTGGACAAGGACGGGCACATTAAGATCACAGACTTCGGGCTGTGCAAGGAGGGGATCAAGGACGGTGCCACCATGAAGACCTTTTGCGGCACACCTGAGTACCTGGCCCCCGAGGTGCTGGAGGACAATGACTACGGCCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTACGAGATGATGTGCGGTCGCCTGCCCTTCTACAACCAGGACCATGAGAAGCTTTTTGAGCTCATCCTCATGGAGGAGATCCGCTTCCCGCGCACGCTTGGTCCCGAGGCCAAGTCCTTGCTTTCAGGGCTGCTCAAGAAGGACCCCAAGCAGAGGCTTGGCGGGGGCTCCGAGGACGCCAAGGAGATCATGCAGCATCGCTTCTTTGCCGGTATCGTGTGGCAGCACGTGTACGAGAAGAAGCTCAGCCCACCCTTCAAGCCCCAGGTCACGTCGGAGACTGACACCAGGTATTTTGATGAGGAGTTCACGGCCCAGATGATCACCATCACACCACCTGACCAAGATGACAGCATGGAGTGTGTGGACAGCGAGCGCAGGCCCCACTTCCCCCAGTTCTCCTACTCGGCCAGCGGCACGGCCTGA |
ORF Protein Sequence | MSDVAIVKEGWLHKRGEYIKTWRPRYFLLKNDGTFIGYKERPQDVDQREAPLNNFSVAQCQLMKTERPRPNTFIIRCLQWTTVIERTFHVETPEEREEWTTAIQTVADGLKKQEEEEMDFRSGSPSDNSGAEEMEVSLAKPKHRVTMNEFEYLKLLGKGTFGKVILVKEKATGRYYAMKILKKEVIVAKDEVAHTLTENRVLQNSRHPFLTALKYSFQTHDRLCFVMEYANGGELFFHLSRERVFSEDRARFYGAEIVSALDYLHSEKNVVYRDLKLENLMLDKDGHIKITDFGLCKEGIKDGATMKTFCGTPEYLAPEVLEDNDYGRAVDWWGLGVVMYEMMCGRLPFYNQDHEKLFELILMEEIRFPRTLGPEAKSLLSGLLKKDPKQRLGGGSEDAKEIMQHRFFAGIVWQHVYEKKLSPPFKPQVTSETDTRYFDEEFTAQMITITPPDQDDSMECVDSERRPHFPQFSYSASGTA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T67619-Ab | Anti-AKT1 monoclonal antibody |
Target Antigen | GM-Tg-g-T67619-Ag | AKT1 protein |
ORF Viral Vector | pGMLP005423 | Human AKT1 Lentivirus plasmid |
ORF Viral Vector | pGMLP005606 | Human AKT1 Lentivirus plasmid |
ORF Viral Vector | pGMLP005800 | Human AKT1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000222 | Human AKT1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000429 | Human AKT1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001602 | Human AKT1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000133 | Human AKT1 Adenovirus plasmid |
ORF Viral Vector | pGMPC000431 | Human AKT1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP005423 | Human AKT1 Lentivirus particle |
ORF Viral Vector | vGMLP005606 | Human AKT1 Lentivirus particle |
ORF Viral Vector | vGMLP005800 | Human AKT1 Lentivirus particle |
ORF Viral Vector | vGMLV000222 | Human AKT1 Lentivirus particle |
ORF Viral Vector | vGMLV000429 | Human AKT1 Lentivirus particle |
ORF Viral Vector | vGMLV001602 | Human AKT1 Lentivirus particle |
ORF Viral Vector | vGMAP000133 | Human AKT1 Adenovirus particle |
Target information
Target ID | GM-T67619 |
Target Name | AKT1 |
Gene ID | 207, 11651, 697747, 24185, 101087931, 490878, 280991, 100061130 |
Gene Symbol and Synonyms | AKT,AKT1,LTR-akt,PKB,PKB-ALPHA,PKB/Akt,PKBalpha,PRKBA,RAC,RAC-ALPHA |
Uniprot Accession | P31749 |
Uniprot Entry Name | AKT1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Non-Small Cell Lung Cancer |
Gene Ensembl | ENSG00000142208 |
Target Classification | Kinase |
This gene encodes one of the three members of the human AKT serine-threonine protein kinase family which are often referred to as protein kinase B alpha, beta, and gamma. These highly similar AKT proteins all have an N-terminal pleckstrin homology domain, a serine/threonine-specific kinase domain and a C-terminal regulatory domain. These proteins are phosphorylated by phosphoinositide 3-kinase (PI3K). AKT/PI3K forms a key component of many signalling pathways that involve the binding of membrane-bound ligands such as receptor tyrosine kinases, G-protein coupled receptors, and integrin-linked kinase. These AKT proteins therefore regulate a wide variety of cellular functions including cell proliferation, survival, metabolism, and angiogenesis in both normal and malignant cells. AKT proteins are recruited to the cell membrane by phosphatidylinositol 3,4,5-trisphosphate (PIP3) after phosphorylation of phosphatidylinositol 4,5-bisphosphate (PIP2) by PI3K. Subsequent phosphorylation of both threonine residue 308 and serine residue 473 is required for full activation of the AKT1 protein encoded by this gene. Phosphorylation of additional residues also occurs, for example, in response to insulin growth factor-1 and epidermal growth factor. Protein phosphatases act as negative regulators of AKT proteins by dephosphorylating AKT or PIP3. The PI3K/AKT signalling pathway is crucial for tumor cell survival. Survival factors can suppress apoptosis in a transcription-independent manner by activating AKT1 which then phosphorylates and inactivates components of the apoptotic machinery. AKT proteins also participate in the mammalian target of rapamycin (mTOR) signalling pathway which controls the assembly of the eukaryotic translation initiation factor 4F (eIF4E) complex and this pathway, in addition to responding to extracellular signals from growth factors and cytokines, is disregulated in many cancers. Mutations in this gene are associated with multiple types of cancer and excessive tissue growth including Proteus syndrome and Cowden syndrome 6, and breast, colorectal, and ovarian cancers. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.