Human STMN1/C1orf215/ Lag ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001145454.3)

Pre-made Human STMN1/C1orf215/ Lag Non-Viral expression plasmid (overexpression vector) for mouse STMN1 overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to STMN1/C1orf215 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000150 Human STMN1 Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000150
Gene Name STMN1
Accession Number NM_001145454.3
Gene ID 3925
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 525 bp
Gene Alias C1orf215, Lag, LAP18, OP18, PP17, PP19, PR22, SMN
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTTCTTCTGATATCCAGGTGAAAGAACTGGAGAAGCGTGCCTCAGGCCAGGCTTTTGAGCTGATTCTCAGCCCTCGGTCAAAAGAATCTGTTCCAGAATTCCCCCTTTCCCCTCCAAAGAAGAAGGATCTTTCCCTGGAGGAAATTCAGAAGAAATTAGAAGCTGCAGAAGAAAGACGCAAGTCCCATGAAGCTGAGGTCTTGAAGCAGCTGGCTGAGAAACGAGAGCACGAGAAAGAAGTGCTTCAGAAGGCAATAGAAGAGAACAACAACTTCAGTAAAATGGCAGAAGAGAAACTGACCCACAAAATGGAAGCTAATAAAGAGAACCGAGAGGCACAAATGGCTGCCAAACTGGAACGTTTGCGAGAGAAGATGTACTTCTGGACTCACGGGCCTGGGGCCCACCCAGCACAGATCTCTGCTGAGCAATCTTGTCTCCACTCTGTTCCTGCCCTTTGCCCAGCCCTGGGCCTCCAATCTGCATTGATTACCTGGTCTGATCTCTCTCACCATCACTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0228-Ab Anti-STMN1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0228-Ag STMN1 protein
    ORF Viral Vector pGMLV000379 Human STMN1 Lentivirus plasmid
    ORF Viral Vector pGMLV000481 Human STMN1 Lentivirus plasmid
    ORF Viral Vector pGMAD000071 Human STMN1 Adenovirus plasmid
    ORF Viral Vector pGMPC000150 Human STMN1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000293 Human STMN1 Adenovirus plasmid
    ORF Viral Vector vGMLV000379 Human STMN1 Lentivirus particle
    ORF Viral Vector vGMLV000481 Human STMN1 Lentivirus particle
    ORF Viral Vector vGMAD000071 Human STMN1 Adenovirus particle
    ORF Viral Vector vGMAP000293 Human STMN1 Adenovirus particle


    Target information

    Target ID GM-IP0228
    Target Name STMN1
    Gene ID 3925, 16765, 719733, 29332, 101082582, 478175, 616317, 100057411
    Gene Symbol and Synonyms 19k,C1orf215,Lag,LAP18,OP18,P18,P19,Pig,PP17,Pp18,PP19,PR22,prosolin,SMN,STMN1
    Uniprot Accession P16949
    Uniprot Entry Name STMN1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000117632
    Target Classification Tumor-associated antigen (TAA)

    This gene belongs to the stathmin family of genes. It encodes a ubiquitous cytosolic phosphoprotein proposed to function as an intracellular relay integrating regulatory signals of the cellular environment. The encoded protein is involved in the regulation of the microtubule filament system by destabilizing microtubules. It prevents assembly and promotes disassembly of microtubules. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.