Human STMN1/Lag/ OP18 ORF/cDNA clone-Adenovirus plasmid (BC082228)
Pre-made Human STMN1/Lag/ OP18 adenoviral expression plasmid for STMN1 adenovirus packaging, STMN1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to STMN1/Lag products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000293 | Human STMN1 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000293 |
Gene Name | STMN1 |
Accession Number | BC082228 |
Gene ID | 3925 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 450 bp |
Gene Alias | Lag, OP18, PP17, PP19, PR22, SMN |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTTCTTCTGATATCCAGGTGAAAGAACTGGAGAAGCGTGCCTCAGGCCAGGCTTTTGAGCTGATTCTCAGCCCTCGGTCAAAAGAATCTGTTCCAGAATTCCCCCTTTCCCCTCCAAAGAAGAAGGATCTTTCCCTGGAGGAAATTCAGAAGAAATTAGAAGCTGCAGAAGAAAGACGCAAGTCCCATGAAGCTGAGGTCTTGAAGCAGCTGGCTGAGAAACGAGAGCACGAGAAAGAAGTGCTTCAGAAGGCAATAGAAGAGAACAACAACTTCAGTAAAATGGCAGAAGAGAAACTGACCCACAAAATGGAAGCTAATAAAGAGAACCGAGAGGCACAAATGGCTGCCAAACTGGAACGTTTGCGAGAGAAGGATAAGCACATTGAAGAAGTGCGGAAGAACAAAGAATCCAAAGACCCTGCTGACGAGACTGAAGCTGACTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0228-Ab | Anti-STMN1 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0228-Ag | STMN1 protein |
ORF Viral Vector | pGMLV000379 | Human STMN1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000481 | Human STMN1 Lentivirus plasmid |
ORF Viral Vector | pGMAD000071 | Human STMN1 Adenovirus plasmid |
ORF Viral Vector | pGMPC000150 | Human STMN1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000293 | Human STMN1 Adenovirus plasmid |
ORF Viral Vector | vGMLV000379 | Human STMN1 Lentivirus particle |
ORF Viral Vector | vGMLV000481 | Human STMN1 Lentivirus particle |
ORF Viral Vector | vGMAD000071 | Human STMN1 Adenovirus particle |
ORF Viral Vector | vGMAP000293 | Human STMN1 Adenovirus particle |
Target information
Target ID | GM-IP0228 |
Target Name | STMN1 |
Gene ID | 3925, 16765, 719733, 29332, 101082582, 478175, 616317, 100057411 |
Gene Symbol and Synonyms | 19k,C1orf215,Lag,LAP18,OP18,P18,P19,Pig,PP17,Pp18,PP19,PR22,prosolin,SMN,STMN1 |
Uniprot Accession | P16949 |
Uniprot Entry Name | STMN1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000117632 |
Target Classification | Tumor-associated antigen (TAA) |
This gene belongs to the stathmin family of genes. It encodes a ubiquitous cytosolic phosphoprotein proposed to function as an intracellular relay integrating regulatory signals of the cellular environment. The encoded protein is involved in the regulation of the microtubule filament system by destabilizing microtubules. It prevents assembly and promotes disassembly of microtubules. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.