Human STMN1/Lag/ OP18 ORF/cDNA clone-Adenovirus particle (BC082228)

Pre-made Human STMN1/Lag/ OP18 Adenovirus for STMN1 overexpression in-vitro and in-vivo. The STMN1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified STMN1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to STMN1/Lag products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000293 Human STMN1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000293
Gene Name STMN1
Accession Number BC082228
Gene ID 3925
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 450 bp
Gene Alias Lag, OP18, PP17, PP19, PR22, SMN
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTTCTTCTGATATCCAGGTGAAAGAACTGGAGAAGCGTGCCTCAGGCCAGGCTTTTGAGCTGATTCTCAGCCCTCGGTCAAAAGAATCTGTTCCAGAATTCCCCCTTTCCCCTCCAAAGAAGAAGGATCTTTCCCTGGAGGAAATTCAGAAGAAATTAGAAGCTGCAGAAGAAAGACGCAAGTCCCATGAAGCTGAGGTCTTGAAGCAGCTGGCTGAGAAACGAGAGCACGAGAAAGAAGTGCTTCAGAAGGCAATAGAAGAGAACAACAACTTCAGTAAAATGGCAGAAGAGAAACTGACCCACAAAATGGAAGCTAATAAAGAGAACCGAGAGGCACAAATGGCTGCCAAACTGGAACGTTTGCGAGAGAAGGATAAGCACATTGAAGAAGTGCGGAAGAACAAAGAATCCAAAGACCCTGCTGACGAGACTGAAGCTGACTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0228-Ab Anti-STMN1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0228-Ag STMN1 protein
    ORF Viral Vector pGMLV000379 Human STMN1 Lentivirus plasmid
    ORF Viral Vector pGMLV000481 Human STMN1 Lentivirus plasmid
    ORF Viral Vector pGMAD000071 Human STMN1 Adenovirus plasmid
    ORF Viral Vector pGMPC000150 Human STMN1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000293 Human STMN1 Adenovirus plasmid
    ORF Viral Vector vGMLV000379 Human STMN1 Lentivirus particle
    ORF Viral Vector vGMLV000481 Human STMN1 Lentivirus particle
    ORF Viral Vector vGMAD000071 Human STMN1 Adenovirus particle
    ORF Viral Vector vGMAP000293 Human STMN1 Adenovirus particle


    Target information

    Target ID GM-IP0228
    Target Name STMN1
    Gene ID 3925, 16765, 719733, 29332, 101082582, 478175, 616317, 100057411
    Gene Symbol and Synonyms 19k,C1orf215,Lag,LAP18,OP18,P18,P19,Pig,PP17,Pp18,PP19,PR22,prosolin,SMN,STMN1
    Uniprot Accession P16949
    Uniprot Entry Name STMN1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000117632
    Target Classification Tumor-associated antigen (TAA)

    This gene belongs to the stathmin family of genes. It encodes a ubiquitous cytosolic phosphoprotein proposed to function as an intracellular relay integrating regulatory signals of the cellular environment. The encoded protein is involved in the regulation of the microtubule filament system by destabilizing microtubules. It prevents assembly and promotes disassembly of microtubules. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.