Human CAV3/LGMD1C/ LQT9 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (nm_033337)

Pre-made Human CAV3/LGMD1C/ LQT9 Non-Viral expression plasmid (overexpression vector) for mouse CAV3 overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to CAV3/LGMD1C products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000372 Human CAV3 Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000372
Gene Name CAV3
Accession Number nm_033337
Gene ID 859
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 456 bp
Gene Alias LGMD1C, LQT9, MPDT, RMD2, VIP-21, VIP21
Fluorescent Reporter
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGATGGCAGAAGAGCACACAGATCTCGAGGCCCAGATCGTCAAGGATATCCACTGCAAGGAGATTGACCTGGTGAACCGAGACCCCAAGAACATTAACGAGGACATAGTCAAGGTGGATTTTGAAGACGTGATCGCAGAGCCTGTGGGCACCTACAGCTTTGACGGCGTGTGGAAGGTGAGCTACACCACCTTCACTGTCTCCAAGTACTGGTGCTACCGTCTGTTGTCCACGCTGCTGGGCGTCCCACTGGCCCTGCTCTGGGGCTTCCTGTTCGCCTGCATCTCCTTCTGCCACATCTGGGCGGTGGTGCCATGCATTAAGAGCTACCTGATCGAGATCCAGTGCATCAGCCACATCTACTCACTCTGCATCCGCACCTTCTGCAACCCACTCTTCGCGGCCCTGGGCCAGGTCTGCAGCAGCATCAAGGTGGTGCTGCGGAAGGAGGTCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0187-Ab Anti-CAV3/ LGMD1C/ LQT9 monoclonal antibody
    Target Antigen GM-Tg-g-MP0187-Ag CAV3 VLP (virus-like particle)
    ORF Viral Vector pGMAD000634 Rat Cav3 Adenovirus plasmid
    ORF Viral Vector pGMAAV000277 Rat Cav3 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000425 Human CAV3 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000507 Rat Cav3 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000372 Human CAV3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP002892 Human CAV3 Lentivirus plasmid
    ORF Viral Vector vGMAD000634 Rat Cav3 Adenovirus particle
    ORF Viral Vector vGMAAV000277 Rat Cav3 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000425 Human CAV3 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000507 Rat Cav3 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP002892 Human CAV3 Lentivirus particle


    Target information

    Target ID GM-MP0187
    Target Name CAV3
    Gene ID 859, 12391, 702163, 29161, 101081453, 484671, 615310, 100058881
    Gene Symbol and Synonyms Cav-3,CAV3,LGMD1C,LQT9,M-cav,MPDT,RMD2,VIP-21,VIP21
    Uniprot Accession P56539
    Uniprot Entry Name CAV3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000182533
    Target Classification Not Available

    This gene encodes a caveolin family member, which functions as a component of the caveolae plasma membranes found in most cell types. Caveolin proteins are proposed to be scaffolding proteins for organizing and concentrating certain caveolin-interacting molecules. Mutations identified in this gene lead to interference with protein oligomerization or intra-cellular routing, disrupting caveolae formation and resulting in Limb-Girdle muscular dystrophy type-1C (LGMD-1C), hyperCKemia or rippling muscle disease (RMD). Alternative splicing has been identified for this locus, with inclusion or exclusion of a differentially spliced intron. In addition, transcripts utilize multiple polyA sites and contain two potential translation initiation sites. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.