Human PPP1CA/PP-1A/ PP1A ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_002708)

Pre-made Human PPP1CA/PP-1A/ PP1A Non-Viral expression plasmid (overexpression vector) for mouse PPP1CA overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to PPP1CA/PP-1A products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000448 Human PPP1CA Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000448
Gene Name PPP1CA
Accession Number NM_002708
Gene ID 5499
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 993 bp
Gene Alias PP-1A, PP1A, PP1alpha, PPP1A
Fluorescent Reporter
Mammalian Cell Selection Puromyocin
Fusion Tag MYC(C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCCGACAGCGAGAAGCTCAACCTGGACTCGATCATCGGGCGCCTGCTGGAAGTGCAGGGCTCGCGGCCTGGCAAGAATGTACAGCTGACAGAGAACGAGATCCGCGGTCTGTGCCTGAAATCCCGGGAGATTTTTCTGAGCCAGCCCATTCTTCTGGAGCTGGAGGCACCCCTCAAGATCTGCGGTGACATACACGGCCAGTACTACGACCTTCTGCGACTATTTGAGTATGGCGGTTTCCCTCCCGAGAGCAACTACCTCTTTCTGGGGGACTATGTGGACAGGGGCAAGCAGTCCTTGGAGACCATCTGCCTGCTGCTGGCCTATAAGATCAAGTACCCCGAGAACTTCTTCCTGCTCCGTGGGAACCACGAGTGTGCCAGCATCAACCGCATCTATGGTTTCTACGATGAGTGCAAGAGACGCTACAACATCAAACTGTGGAAAACCTTCACTGACTGCTTCAACTGCCTGCCCATCGCGGCCATAGTGGACGAAAAGATCTTCTGCTGCCACGGAGGCCTGTCCCCGGACCTGCAGTCTATGGAGCAGATTCGGCGGATCATGCGGCCCACAGATGTGCCTGACCAGGGCCTGCTGTGTGACCTGCTGTGGTCTGACCCTGACAAGGACGTGCAGGGCTGGGGCGAGAACGACCGTGGCGTCTCTTTTACCTTTGGAGCCGAGGTGGTGGCCAAGTTCCTCCACAAGCACGACTTGGACCTCATCTGCCGAGCACACCAGGTGGTAGAAGACGGCTACGAGTTCTTTGCCAAGCGGCAGCTGGTGACACTTTTCTCAGCTCCCAACTACTGTGGCGAGTTTGACAATGCTGGCGCCATGATGAGTGTGGACGAGACCCTCATGTGCTCTTTCCAGATCCTCAAGCCCGCCGACAAGAACAAGGGGAAGTACGGGCAGTTCAGTGGCCTGAACCCTGGAGGCCGACCCATCACCCCACCCCGCAATTCCGCCAAAGCCAAGAAATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T59845-Ab Anti-PP1A/ PPP1CA/ PP-1A monoclonal antibody
    Target Antigen GM-Tg-g-T59845-Ag PPP1CA VLP (virus-like particle)
    ORF Viral Vector pGMPC000448 Human PPP1CA Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP000473 Human PPP1CA Lentivirus plasmid
    ORF Viral Vector pGMAP000389 Human PPP1CA Adenovirus plasmid
    ORF Viral Vector vGMLP000473 Human PPP1CA Lentivirus particle
    ORF Viral Vector vGMAP000389 Human PPP1CA Adenovirus particle


    Target information

    Target ID GM-T59845
    Target Name PPP1CA
    Gene ID 5499, 19045, 721735, 24668, 109492306, 403609, 516175, 100059233
    Gene Symbol and Synonyms dism2,PP-1A,PP1A,PP1alpha,PPP1A,Ppp1c,PPP1CA
    Uniprot Accession P62136
    Uniprot Entry Name PP1A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000172531
    Target Classification Not Available

    The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). This broadly expressed gene encodes the alpha subunit of the PP1 complex that associates with over 200 regulatory proteins to form holoenzymes which dephosphorylate their biological targets with high specificity. PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Increased PP1 activity has been observed in the end stage of heart failure. Studies suggest that PP1 is an important regulator of cardiac function and that PP1 deregulation is implicated in diabetes and multiple types of cancer. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.