Human PPP1CA/PP-1A/ PP1A ORF/cDNA clone-Lentivirus particle (NM_002708)
Pre-made Human PPP1CA/PP-1A/ PP1A Lentiviral expression plasmid for PPP1CA lentivirus packaging, PPP1CA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to PPP1CA/PP-1A products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000473 | Human PPP1CA Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000473 |
Gene Name | PPP1CA |
Accession Number | NM_002708 |
Gene ID | 5499 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 993 bp |
Gene Alias | PP-1A, PP1A, PP1alpha, PPP1A |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCCGACAGCGAGAAGCTCAACCTGGACTCGATCATCGGGCGCCTGCTGGAAGTGCAGGGCTCGCGGCCTGGCAAGAATGTACAGCTGACAGAGAACGAGATCCGCGGTCTGTGCCTGAAATCCCGGGAGATTTTTCTGAGCCAGCCCATTCTTCTGGAGCTGGAGGCACCCCTCAAGATCTGCGGTGACATACACGGCCAGTACTACGACCTTCTGCGACTATTTGAGTATGGCGGTTTCCCTCCCGAGAGCAACTACCTCTTTCTGGGGGACTATGTGGACAGGGGCAAGCAGTCCTTGGAGACCATCTGCCTGCTGCTGGCCTATAAGATCAAGTACCCCGAGAACTTCTTCCTGCTCCGTGGGAACCACGAGTGTGCCAGCATCAACCGCATCTATGGTTTCTACGATGAGTGCAAGAGACGCTACAACATCAAACTGTGGAAAACCTTCACTGACTGCTTCAACTGCCTGCCCATCGCGGCCATAGTGGACGAAAAGATCTTCTGCTGCCACGGAGGCCTGTCCCCGGACCTGCAGTCTATGGAGCAGATTCGGCGGATCATGCGGCCCACAGATGTGCCTGACCAGGGCCTGCTGTGTGACCTGCTGTGGTCTGACCCTGACAAGGACGTGCAGGGCTGGGGCGAGAACGACCGTGGCGTCTCTTTTACCTTTGGAGCCGAGGTGGTGGCCAAGTTCCTCCACAAGCACGACTTGGACCTCATCTGCCGAGCACACCAGGTGGTAGAAGACGGCTACGAGTTCTTTGCCAAGCGGCAGCTGGTGACACTTTTCTCAGCTCCCAACTACTGTGGCGAGTTTGACAATGCTGGCGCCATGATGAGTGTGGACGAGACCCTCATGTGCTCTTTCCAGATCCTCAAGCCCGCCGACAAGAACAAGGGGAAGTACGGGCAGTTCAGTGGCCTGAACCCTGGAGGCCGACCCATCACCCCACCCCGCAATTCCGCCAAAGCCAAGAAATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T59845-Ab | Anti-PP1A/ PPP1CA/ PP-1A monoclonal antibody |
Target Antigen | GM-Tg-g-T59845-Ag | PPP1CA VLP (virus-like particle) |
ORF Viral Vector | pGMPC000448 | Human PPP1CA Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP000473 | Human PPP1CA Lentivirus plasmid |
ORF Viral Vector | pGMAP000389 | Human PPP1CA Adenovirus plasmid |
ORF Viral Vector | vGMLP000473 | Human PPP1CA Lentivirus particle |
ORF Viral Vector | vGMAP000389 | Human PPP1CA Adenovirus particle |
Target information
Target ID | GM-T59845 |
Target Name | PPP1CA |
Gene ID | 5499, 19045, 721735, 24668, 109492306, 403609, 516175, 100059233 |
Gene Symbol and Synonyms | dism2,PP-1A,PP1A,PP1alpha,PPP1A,Ppp1c,PPP1CA |
Uniprot Accession | P62136 |
Uniprot Entry Name | PP1A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000172531 |
Target Classification | Not Available |
The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). This broadly expressed gene encodes the alpha subunit of the PP1 complex that associates with over 200 regulatory proteins to form holoenzymes which dephosphorylate their biological targets with high specificity. PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Increased PP1 activity has been observed in the end stage of heart failure. Studies suggest that PP1 is an important regulator of cardiac function and that PP1 deregulation is implicated in diabetes and multiple types of cancer. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.