Human PPP1CA/MGC15877/ MGC1674 ORF/cDNA clone-Adenovirus particle (BC001888)
Pre-made Human PPP1CA/MGC15877/ MGC1674 Adenovirus for PPP1CA overexpression in-vitro and in-vivo. The PPP1CA adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PPP1CA-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to PPP1CA/MGC15877 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000389 | Human PPP1CA Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000389 |
Gene Name | PPP1CA |
Accession Number | BC001888 |
Gene ID | 5499 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 993 bp |
Gene Alias | MGC15877, MGC1674, PP-1A |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCCGACAGCGAGAAGCTCAACCTGGACTCGATCATCGGGCGCCTGCTGGAAGTGCAGGGCTCGCGGCCTGGCAAGAATGTACAGCTGACAGAGAACGAGATCCGCGGTCTGTGCCTGAAATCCCGGGAGATTTTTCTGAGCCAGCCCATTCTTCTGGAGCTGGAGGCACCCCTCAAGATCTGCGGTGACATACACGGCCAGTACTACGACCTTCTGCGACTATTTGAGTATGGCGGTTTCCCTCCCGAGAGCAACTACCTCTTTCTGGGGGACTATGTGGACAGGGGCAAGCAGTCCTTGGAGACCATCTGCCTGCTGCTGGCCTATAAGATCAAGTACCCCGAGAACTTCTTCCTGCTCCGTGGGAACCACGAGTGTGCCAGCATCAACCGCATCTATGGTTTCTACGATGAGTGCAAGAGACGCTACAACATCAAACTGTGGAAAACCTTCACTGACTGCTTCAACTGCCTGCCCATCGCGGCCATAGTGGACGAAAAGATCTTCTGCTGCCACGGAGGCCTGTCCCCGGACCTGCAGTCTATGGAGCAGATTCGGCGGATCATGCGGCCCACAGATGTGCCTGACCAGGGCCTGCTGTGTGACCTGCTGTGGTCTGACCCTGACAAGGACGTGCAGGGCTGGGGCGAGAACGACCGTGGCGTCTCTTTTACCTTTGGAGCCGAGGTGGTGGCCAAGTTCCTCCACAAGCACGACTTGGACCTCATCTGCCGAGCACACCAGGTGGTAGAAGACGGCTACGAGTTCTTTGCCAAGCGGCAGCTGGTGACACTTTTCTCAGCTCCCAACTACTGTGGCGAGTTTGACAATGCTGGCGCCATGATGAGTGTGGACGAGACCCTCATGTGCTCTTTCCAGATCCTCAAGCCCGCCGACAAGAACAAGGGGAAGTACGGGCAGTTCAGTGGCCTGAACCCTGGAGGCCGACCCATCACCCCACCCCGCAATTCCGCCAAAGCCAAGAAATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T59845-Ab | Anti-PP1A/ PPP1CA/ PP-1A monoclonal antibody |
Target Antigen | GM-Tg-g-T59845-Ag | PPP1CA VLP (virus-like particle) |
ORF Viral Vector | pGMPC000448 | Human PPP1CA Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP000473 | Human PPP1CA Lentivirus plasmid |
ORF Viral Vector | pGMAP000389 | Human PPP1CA Adenovirus plasmid |
ORF Viral Vector | vGMLP000473 | Human PPP1CA Lentivirus particle |
ORF Viral Vector | vGMAP000389 | Human PPP1CA Adenovirus particle |
Target information
Target ID | GM-T59845 |
Target Name | PPP1CA |
Gene ID | 5499, 19045, 721735, 24668, 109492306, 403609, 516175, 100059233 |
Gene Symbol and Synonyms | dism2,PP-1A,PP1A,PP1alpha,PPP1A,Ppp1c,PPP1CA |
Uniprot Accession | P62136 |
Uniprot Entry Name | PP1A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000172531 |
Target Classification | Not Available |
The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). This broadly expressed gene encodes the alpha subunit of the PP1 complex that associates with over 200 regulatory proteins to form holoenzymes which dephosphorylate their biological targets with high specificity. PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Increased PP1 activity has been observed in the end stage of heart failure. Studies suggest that PP1 is an important regulator of cardiac function and that PP1 deregulation is implicated in diabetes and multiple types of cancer. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.