Product information
Catalog No. |
Product Name |
Plasmid Grade |
Plasmid quantity |
pGMPC000459 |
Human CD274 Mammalian (Non-Viral Vector) plasmid |
Research Grade |
10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade |
10mg, 50mg, 100mg, 500mg, >1g |
High Quality (HQ) Grade |
|
Seed |
5ug |
Product Description
Catalog ID |
pGMPC000459 |
Gene Name |
CD274 |
Accession Number |
NM_014143.3 |
Gene ID |
29126 |
Species |
Human |
Product Type |
Mammalian (Non-Viral Vector) plasmid (overexpression) |
Insert Length |
873 bp |
Gene Alias |
B7-H, B7H1, PD-L1, PDCD1L1, PDCD1LG1, PDL1 |
Fluorescent Reporter |
EGFP |
Mammalian Cell Selection |
|
Fusion Tag |
3xflag (C-Terminal) |
Promoter |
CMV |
Resistance |
Amplicin |
Sequence |
ATGAGGATATTTGCTGTCTTTATATTCATGACCTACTGGCATTTGCTGAACGCATTTACTGTCACGGTTCCCAAGGACCTATATGTGGTAGAGTATGGTAGCAATATGACAATTGAATGCAAATTCCCAGTAGAAAAACAATTAGACCTGGCTGCACTAATTGTCTATTGGGAAATGGAGGATAAGAACATTATTCAATTTGTGCATGGAGAGGAAGACCTGAAGGTTCAGCATAGTAGCTACAGACAGAGGGCCCGGCTGTTGAAGGACCAGCTCTCCCTGGGAAATGCTGCACTTCAGATCACAGATGTGAAATTGCAGGATGCAGGGGTGTACCGCTGCATGATCAGCTATGGTGGTGCCGACTACAAGCGAATTACTGTGAAAGTCAATGCCCCATACAACAAAATCAACCAAAGAATTTTGGTTGTGGATCCAGTCACCTCTGAACATGAACTGACATGTCAGGCTGAGGGCTACCCCAAGGCCGAAGTCATCTGGACAAGCAGTGACCATCAAGTCCTGAGTGGTAAGACCACCACCACCAATTCCAAGAGAGAGGAGAAGCTTTTCAATGTGACCAGCACACTGAGAATCAACACAACAACTAATGAGATTTTCTACTGCACTTTTAGGAGATTAGATCCTGAGGAAAACCATACAGCTGAATTGGTCATCCCAGAACTACCTCTGGCACATCCTCCAAATGAAAGGACTCACTTGGTAATTCTGGGAGCCATCTTATTATGCCTTGGTGTAGCACTGACATTCATCTTCCGTTTAAGAAAAGGGAGAATGATGGATGTGAAAAAATGTGGCATCCAAGATACAAACTCAAAGAAGCAAAGTGATACACATTTGGAGGAGACGTAA
|
Reference
Data / case study
Click to get more Data /
Case study about the product.
Associated products
Category |
Cat No. |
Products Name |
Biosimilar |
GMP-Bios-ab-422 |
Pre-Made Pacmilimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-040 |
Pre-Made Avelumab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Biosimilar |
GMP-Bios-INN-972 |
Pre-Made Retlirafusp Alfa Biosimilar, Fusion Protein targeting CD274/PD-L1 fused with human TGFBR2 (transforming growth factor beta receptor 2) extracellular fragment (20-136) via a peptidyl linker: Recombinant therapeutic protein targeting B7-H/B7H1/PDCD1L1/PDCD1LG1
|
Biosimilar |
GMP-Bios-ab-034 |
Pre-Made Atezolizumab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-159 |
Pre-Made Durvalumab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-534 |
Pre-Made Sugemalimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-409 |
Pre-Made Opucolimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-188 |
Pre-Made Envafolimab biosimilar, Single Domain Variable Fragment;H, Anti-CD274/PD-L1 Antibody: Anti-B7-H, B7H1, PD-L1, PDCD1L1, PDCD1LG1, PDL1, hPD-L1 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-533 |
Pre-Made Sudubrilimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-071 |
Pre-Made Bintrafusp biosimilar, Whole mAb Fusion, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-481 |
Pre-Made Retlirafusp biosimilar, Whole mAb Fusion, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-698 |
Pre-Made Tagitanlimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Biosimilar |
GMP-Bios-INN-797 |
Pre-Made Davoceticept Biosimilar, Fusion Protein targeting CD274/PD-L1 fused with human IGHG1 Fc (Fragment constant) via a peptidyl linker: Recombinant therapeutic protein targeting B7-H/B7H1/PDCD1L1/PDCD1LG1
|
Biosimilar |
GMP-Bios-ab-121 |
Pre-Made Cosibelimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Biosimilar |
GMP-Bios-INN-762 |
Pre-Made Bintrafusp Alfa Biosimilar, Fusion Protein targeting CD274/PD-L1 fused with human TGFBR2 (transforming growth factor beta receptor 2) (1:2) via a peptidyl linker: Recombinant therapeutic protein targeting B7-H/B7H1/PDCD1L1/PDCD1LG1
|
Biosimilar |
GMP-Bios-ab-317 |
Pre-Made Lodapolimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-194 |
Pre-Made Erfonrilimab biosimilar, Bispecific Single Domains (VH-VH'-CH), Anti-CD274/PD-L1;CTLA4/CTLA-4 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1;CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-010 |
Pre-Made Adebrelimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-693 |
Pre-Made Simridarlimab biosimilar, Whole mAb, Anti-CD47;CD274/PD-L1 Antibody: Anti-IAP/OA3/MER6;B7-H/B7H1/PD-L1/PDCD1L1/PDCD1LG1/PDL1/hPD-L1 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-235 |
Pre-Made Garivulimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-695 |
Pre-Made Socazolimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-007 |
Pre-Made Acasunlimab biosimilar, Bispecific mAb, Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1/PDL1/hPD-L1;ILA/4-1BB/CDw137 Antibod: Anti-CD274/PD-L1;TNFRSF9/CD137 therapeutic antibody
|
Biosimilar |
GMP-Bios-ab-334 |
Pre-Made Manelimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
|
Target Antibody |
GM-Tg-g-T99948-Ab |
Anti-PD1L1/ PD-L1/ CD274 monoclonal antibody
|
Target Antigen |
GM-Tg-g-T99948-Ag |
PD-L1/CD274 VLP (virus-like particle)
|
ORF Viral Vector |
pGMLV000121 |
Human CD274 Lentivirus plasmid |
ORF Viral Vector |
pGMLV000710 |
Human CD274 Lentivirus plasmid |
ORF Viral Vector |
pGMLV000749 |
Human CD274 Lentivirus plasmid |
ORF Viral Vector |
pGMLV001704 |
Human CD274 Lentivirus plasmid |
ORF Viral Vector |
pGMLV001797 |
Human CD274 Lentivirus plasmid |
ORF Viral Vector |
pGMLV001918 |
Human CD274 Lentivirus plasmid |
ORF Viral Vector |
pGMPC000014 |
Human CD274 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector |
pGMPC000459 |
Human CD274 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector |
pGMPC000807 |
Human CD274 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector |
pGMPC001107 |
Human CD274 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector |
vGMLV000121 |
Human CD274 Lentivirus particle |
ORF Viral Vector |
vGMLV000710 |
Human CD274 Lentivirus particle |
ORF Viral Vector |
vGMLV000749 |
Human CD274 Lentivirus particle |
ORF Viral Vector |
vGMLV001704 |
Human CD274 Lentivirus particle |
ORF Viral Vector |
vGMLV001797 |
Human CD274 Lentivirus particle |
ORF Viral Vector |
vGMLV001918 |
Human CD274 Lentivirus particle |
ORF Viral Vector |
pGMLV002461 |
Human CD274 Lentivirus plasmid |
ORF Viral Vector |
pGMAD001278 |
Human CD274 Adenovirus plasmid |
Target information
Target ID |
GM-T99948
|
Target Name |
PD-L1
|
Gene ID |
29126, 60533, 716043, 499342, 100127110, 484186, 533834, 100051703
|
Gene Symbol and Synonyms |
A530045L16Rik,B7-H,B7H1,CD274,hPD-L1,PD-L1,PDCD1L1,PDCD1LG1,PDL1,RGD1566211
|
Uniprot Accession |
Q9NZQ7 |
Uniprot Entry Name |
PD1L1_HUMAN
|
Protein Sub-location |
Transmembrane Protein
|
Category |
Therapeutics Target, Immuno-oncology Target, INN Index
|
Disease |
Cancer
|
Gene Ensembl |
ENSG00000120217
|
Target Classification |
Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)
|
This gene encodes an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Expression of this gene in tumor cells is considered to be prognostic in many types of human malignancies, including colon cancer and renal cell carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.