Human CD274/B7-H/B7H1 ORF/cDNA clone-Lentivirus particle (NM_014143.3)
                                                               Cat. No.: vGMLV000121
 
                                                               
                                                               
                                                                
                                                                
                                                                 
                                                                
                                                            
Pre-made Human CD274/B7-H/B7H1 Lentiviral expression plasmid for CD274 lentivirus packaging, CD274 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
                                                                            PD-L1/CD274/B7-H products
                                                                            collection>>
(antibodies,
                                                                            antigen, VLP, mRNA, ORF viral vector, etc)
                                                                        
                                                                    
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity | 
|---|---|---|---|
| vGMLV000121 | Human CD274 Lentivirus particle | Pilot Grade | 1.0E+8TU | 
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry | 
Product Description
| Catalog ID | vGMLV000121 | 
| Gene Name | CD274 | 
| Accession Number | NM_014143.3 | 
| Gene ID | 29126 | 
| Species | Human | 
| Product Type | Lentivirus particle (overexpression) | 
| Insert Length | 873 bp | 
| Gene Alias | B7-H,B7H1,PD-L1,PDCD1L1,PDCD1LG1,PDL1 | 
| Fluorescent Reporter | ZsGreen | 
| Mammalian Cell Selection | Puromyocin | 
| Fusion Tag | 3xflag (C-Terminal) | 
| Promoter | CMV | 
| Resistance | Amplicin | 
| ORF Nucleotide Sequence | ATGAGGATATTTGCTGTCTTTATATTCATGACCTACTGGCATTTGCTGAACGCATTTACTGTCACGGTTCCCAAGGACCTATATGTGGTAGAGTATGGTAGCAATATGACAATTGAATGCAAATTCCCAGTAGAAAAACAATTAGACCTGGCTGCACTAATTGTCTATTGGGAAATGGAGGATAAGAACATTATTCAATTTGTGCATGGAGAGGAAGACCTGAAGGTTCAGCATAGTAGCTACAGACAGAGGGCCCGGCTGTTGAAGGACCAGCTCTCCCTGGGAAATGCTGCACTTCAGATCACAGATGTGAAATTGCAGGATGCAGGGGTGTACCGCTGCATGATCAGCTATGGTGGTGCCGACTACAAGCGAATTACTGTGAAAGTCAATGCCCCATACAACAAAATCAACCAAAGAATTTTGGTTGTGGATCCAGTCACCTCTGAACATGAACTGACATGTCAGGCTGAGGGCTACCCCAAGGCCGAAGTCATCTGGACAAGCAGTGACCATCAAGTCCTGAGTGGTAAGACCACCACCACCAATTCCAAGAGAGAGGAGAAGCTTTTCAATGTGACCAGCACACTGAGAATCAACACAACAACTAATGAGATTTTCTACTGCACTTTTAGGAGATTAGATCCTGAGGAAAACCATACAGCTGAATTGGTCATCCCAGAACTACCTCTGGCACATCCTCCAAATGAAAGGACTCACTTGGTAATTCTGGGAGCCATCTTATTATGCCTTGGTGTAGCACTGACATTCATCTTCCGTTTAAGAAAAGGGAGAATGATGGATGTGAAAAAATGTGGCATCCAAGATACAAACTCAAAGAAGCAAAGTGATACACATTTGGAGGAGACGTAA | 
| ORF Protein Sequence | MRIFAVFIFMTYWHLLNAFTVTVPKDLYVVEYGSNMTIECKFPVEKQLDLAALIVYWEMEDKNIIQFVHGEEDLKVQHSSYRQRARLLKDQLSLGNAALQITDVKLQDAGVYRCMISYGGADYKRITVKVNAPYNKINQRILVVDPVTSEHELTCQAEGYPKAEVIWTSSDHQVLSGKTTTTNSKREEKLFNVTSTLRINTTTNEIFYCTFRRLDPEENHTAELVIPELPLAHPPNERTHLVILGAILLCLGVALTFIFRLRKGRMMDVKKCGIQDTNSKKQSDTHLEET | 
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
| Target ID | GM-T99948 | 
| Target Name | PD-L1 | 
| Gene ID | 29126, 60533, 716043, 499342, 100127110, 484186, 533834, 100051703 | 
| Gene Symbol and Synonyms | A530045L16Rik,B7-H,B7H1,CD274,hPD-L1,PD-L1,PDCD1L1,PDCD1LG1,PDL1,RGD1566211 | 
| Uniprot Accession | Q9NZQ7 | 
| Uniprot Entry Name | PD1L1_HUMAN | 
| Protein Sub-location | Transmembrane Protein | 
| Category | Therapeutics Target, Immuno-oncology Target, INN Index | 
| Disease | Cancer | 
| Gene Ensembl | ENSG00000120217 | 
| Target Classification | Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA) | 
This gene encodes an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Expression of this gene in tumor cells is considered to be prognostic in many types of human malignancies, including colon cancer and renal cell carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
                
                
            
        
        
                                                            

