Human CCR4/CC-CKR-4/ CD194 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_005508.5)
Pre-made Human CCR4/CC-CKR-4/ CD194 Non-Viral expression plasmid (overexpression vector) for mouse CCR4 overexpression in unique cell transient transfection and stable cell line development.
Go
to CCR4/CC-CKR-4 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMPC000641 | Human CCR4 Mammalian (Non-Viral Vector) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMPC000641 |
Gene Name | CCR4 |
Accession Number | NM_005508.5 |
Gene ID | 1233 |
Species | Human |
Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
Insert Length | 1083 bp |
Gene Alias | CC-CKR-4, CD194, ChemR13, CKR4, CMKBR4, HGCN:14099, K5-5 |
Fluorescent Reporter | |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAACCCCACGGATATAGCAGACACCACCCTCGATGAAAGCATATACAGCAATTACTATCTGTATGAAAGTATCCCCAAGCCTTGCACCAAAGAAGGCATCAAGGCATTTGGGGAGCTCTTCCTGCCCCCACTGTATTCCTTGGTTTTTGTATTTGGTCTGCTTGGAAATTCTGTGGTGGTTCTGGTCCTGTTCAAATACAAGCGGCTCAGGTCCATGACTGATGTGTACCTGCTCAACCTTGCCATCTCGGATCTGCTCTTCGTGTTTTCCCTCCCTTTTTGGGGCTACTATGCAGCAGACCAGTGGGTTTTTGGGCTAGGTCTGTGCAAGATGATTTCCTGGATGTACTTGGTGGGCTTTTACAGTGGCATATTCTTTGTCATGCTCATGAGCATTGATAGATACCTGGCAATTGTGCACGCGGTGTTTTCCTTGAGGGCAAGGACCTTGACTTATGGGGTCATCACCAGTTTGGCTACATGGTCAGTGGCTGTGTTCGCCTCCCTTCCTGGCTTTCTGTTCAGCACTTGTTATACTGAGCGCAACCATACCTACTGCAAAACCAAGTACTCTCTCAACTCCACGACGTGGAAGGTTCTCAGCTCCCTGGAAATCAACATTCTCGGATTGGTGATCCCCTTAGGGATCATGCTGTTTTGCTACTCCATGATCATCAGGACCTTGCAGCATTGTAAAAATGAGAAGAAGAACAAGGCGGTGAAGATGATCTTTGCCGTGGTGGTCCTCTTCCTTGGGTTCTGGACACCTTACAACATAGTGCTCTTCCTAGAGACCCTGGTGGAGCTAGAAGTCCTTCAGGACTGCACCTTTGAAAGATACTTGGACTATGCCATCCAGGCCACAGAAACTCTGGCTTTTGTTCACTGCTGCCTTAATCCCATCATCTACTTTTTTCTGGGGGAGAAATTTCGCAAGTACATCCTACAGCTCTTCAAAACCTGCAGGGGCCTTTTTGTGCTCTGCCAATACTGTGGGCTCCTCCAAATTTACTCTGCTGACACCCCCAGCTCATCTTACACGCAGTCCACCATGGATCATGATCTCCATGATGCTCTGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-354 | Pre-Made Mogamulizumab biosimilar, Whole mAb, Anti-CCR4 Antibody: Anti-CKR4/K5-5/CD194/CMKBR4/ChemR13/CC-CKR-4/HGCN:14099 therapeutic antibody |
Target Antibody | GM-Tg-g-T06955-Ab | Anti-CCR4/ CC-CKR-4/ CD194 monoclonal antibody |
Target Antigen | GM-Tg-g-T06955-Ag | CCR4 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T06955 | chemokine (C-C motif) receptor 4 (CCR4) protein & antibody |
ORF Viral Vector | pGMPC000641 | Human CCR4 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP002020 | Human CCR4 Lentivirus plasmid |
ORF Viral Vector | vGMLP002020 | Human CCR4 Lentivirus particle |
Target information
Target ID | GM-T06955 |
Target Name | CCR4 |
Gene ID | 1233, 12773, 705457, 171054, 102900629, 403541, 408019, 100056549 |
Gene Symbol and Synonyms | C-C CKR-4,CC-CKR-4,CCR4,CD194,CHEMR1,ChemR13,CKR4,CMKBR4,HGCN:14099,K5-5,LESTR,Sdf1r |
Uniprot Accession | P51679 |
Uniprot Entry Name | CCR4_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000183813 |
Target Classification | Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA) |
The protein encoded by this gene belongs to the G-protein-coupled receptor family . It is a receptor for the CC chemokine - MIP-1, RANTES, TARC and MCP-1. Chemokines are a group of small polypeptide, structurally related molecules that regulate cell trafficking of various types of leukocytes. The chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.