- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human CCR4/CC-CKR-4/ CD194 ORF/cDNA clone-Lentivirus particle (NM_005508)
Pre-made Human CCR4/CC-CKR-4/ CD194 Lentiviral expression plasmid for CCR4 lentivirus packaging, CCR4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CCR4/CC-CKR-4 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP002020 | Human CCR4 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP002020 |
| Gene Name | CCR4 |
| Accession Number | NM_005508 |
| Gene ID | 1233 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1083 bp |
| Gene Alias | CC-CKR-4, CD194, ChemR13, CKR4, CMKBR4, HGCN:14099, K5-5 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGAACCCCACGGATATAGCAGACACCACCCTCGATGAAAGCATATACAGCAATTACTATCTGTATGAAAGTATCCCCAAGCCTTGCACCAAAGAAGGCATCAAGGCATTTGGGGAGCTCTTCCTGCCCCCACTGTATTCCTTGGTTTTTGTATTTGGTCTGCTTGGAAATTCTGTGGTGGTTCTGGTCCTGTTCAAATACAAGCGGCTCAGGTCCATGACTGATGTGTACCTGCTCAACCTTGCCATCTCGGATCTGCTCTTCGTGTTTTCCCTCCCTTTTTGGGGCTACTATGCAGCAGACCAGTGGGTTTTTGGGCTAGGTCTGTGCAAGATGATTTCCTGGATGTACTTGGTGGGCTTTTACAGTGGCATATTCTTTGTCATGCTCATGAGCATTGATAGATACCTGGCAATTGTGCACGCGGTGTTTTCCTTGAGGGCAAGGACCTTGACTTATGGGGTCATCACCAGTTTGGCTACATGGTCAGTGGCTGTGTTCGCCTCCCTTCCTGGCTTTCTGTTCAGCACTTGTTATACTGAGCGCAACCATACCTACTGCAAAACCAAGTACTCTCTCAACTCCACGACGTGGAAGGTTCTCAGCTCCCTGGAAATCAACATTCTCGGATTGGTGATCCCCTTAGGGATCATGCTGTTTTGCTACTCCATGATCATCAGGACCTTGCAGCATTGTAAAAATGAGAAGAAGAACAAGGCGGTGAAGATGATCTTTGCCGTGGTGGTCCTCTTCCTTGGGTTCTGGACACCTTACAACATAGTGCTCTTCCTAGAGACCCTGGTGGAGCTAGAAGTCCTTCAGGACTGCACCTTTGAAAGATACTTGGACTATGCCATCCAGGCCACAGAAACTCTGGCTTTTGTTCACTGCTGCCTTAATCCCATCATCTACTTTTTTCTGGGGGAGAAATTTCGCAAGTACATCCTACAGCTCTTCAAAACCTGCAGGGGCCTTTTTGTGCTCTGCCAATACTGTGGGCTCCTCCAAATTTACTCTGCTGACACCCCCAGCTCATCTTACACGCAGTCCACCATGGATCATGATCTCCATGATGCTCTGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-354 | Pre-Made Mogamulizumab biosimilar, Whole mAb, Anti-CCR4 Antibody: Anti-CKR4/K5-5/CD194/CMKBR4/ChemR13/CC-CKR-4/HGCN:14099 therapeutic antibody |
| Target Antibody | GM-Tg-g-T06955-Ab | Anti-CCR4/ CC-CKR-4/ CD194 monoclonal antibody |
| Target Antigen | GM-Tg-g-T06955-Ag | CCR4 VLP (virus-like particle) |
| Cytokine | cks-Tg-g-GM-T06955 | chemokine (C-C motif) receptor 4 (CCR4) protein & antibody |
| ORF Viral Vector | pGMPC000641 | Human CCR4 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMLP002020 | Human CCR4 Lentivirus plasmid |
| ORF Viral Vector | vGMLP002020 | Human CCR4 Lentivirus particle |
Target information
| Target ID | GM-T06955 |
| Target Name | CCR4 |
| Gene ID | 1233, 12773, 705457, 171054, 102900629, 403541, 408019, 100056549 |
| Gene Symbol and Synonyms | C-C CKR-4,CC-CKR-4,CCR4,CD194,CHEMR1,ChemR13,CKR4,CMKBR4,HGCN:14099,K5-5,LESTR,Sdf1r |
| Uniprot Accession | P51679 |
| Uniprot Entry Name | CCR4_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000183813 |
| Target Classification | Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA) |
The protein encoded by this gene belongs to the G-protein-coupled receptor family . It is a receptor for the CC chemokine - MIP-1, RANTES, TARC and MCP-1. Chemokines are a group of small polypeptide, structurally related molecules that regulate cell trafficking of various types of leukocytes. The chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
