Human NR1I3/CAR/ CAR1 ORF/cDNA clone-Lentivirus plasmid (NM_001077482)
Pre-made Human NR1I3/CAR/ CAR1 Lentiviral expression plasmid for NR1I3 lentivirus packaging, NR1I3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to NR1I3/CAR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002652 | Human NR1I3 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002652 |
Gene Name | NR1I3 |
Accession Number | NM_001077482 |
Gene ID | 9970 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1074 bp |
Gene Alias | CAR, CAR1, MB67 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCAGTAGGGAAGATGAGCTGAGGAACTGTGTGGTATGTGGGGACCAAGCCACAGGCTACCACTTTAATGCGCTGACTTGTGAGGGCTGCAAGGGTTTCTTCAGGAGAACAGTCAGCAAAAGCATTGGTCCCACCTGCCCCTTTGCTGGAAGCTGTGAAGTCAGCAAGACTCAGAGGCGCCACTGCCCAGCCTGCAGGTTGCAGAAGTGCTTAGATGCTGGCATGAGGAAAGACATGATACTGTCGGCAGAAGCCCTGGCATTGCGGCGAGCAAAGCAGGCCCAGCGGCGGGCACAGCAAACACCTGTGCAACTGAGTAAGGAGCAAGAAGAGCTGATCCGGACACTCCTGGGGGCCCACACCCGCCACATGGGCACCATGTTTGAACAGTTTGTGCAGTTTAGGCCTCCAGCTCATCTGTTCATCCATCACCAGCCCTTGCCCACCCTGGCCCCTGTGCTGCCTCTGGTCACACACTTCGCAGACATCAACACTTTCATGGTACTGCAAGTCATCAAGTTTACTAAGGACCTGCCCGTCTTCCGTTCCCTGCCCATTGAAGACCAGATCTCCCTTCTCAAGGGAGCAGCTGTGGAAATCTGTCACATCGTACTCAATACCACTTTCTGTCTCCAAACACAAAACTTCCTCTGCGGGCCTCTTCGCTACACAATTGAAGATGGAGCCCGTGTATCTCCCACAGTGGGGTTCCAGGTAGAGTTTTTGGAGTTGCTCTTTCACTTCCATGGAACACTACGAAAACTGCAGCTCCAAGAGCCTGAGTATGTGCTCTTGGCTGCCATGGCCCTCTTCTCTCCTGCTCCCTATCTTACAGACCGACCTGGAGTTACCCAGAGAGATGAGATTGATCAGCTGCAAGAGGAGATGGCACTGACTCTGCAAAGCTACATCAAGGGCCAGCAGCGAAGGCCCCGGGATCGGTTTCTGTATGCGAAGTTGCTAGGCCTGCTGGCTGAGCTCCGGAGCATTAATGAGGCCTACGGGTACCAAATCCAGCACATCCAGGGCCTGTCTGCCATGATGCCGCTGCTCCAGGAGATCTGCAGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T69506-Ab | Anti-NR1I3 monoclonal antibody |
Target Antigen | GM-Tg-g-T69506-Ag | NR1I3 protein |
ORF Viral Vector | pGMAD000501 | Human NR1I3 Adenovirus plasmid |
ORF Viral Vector | pGMAAV000746 | Rat Nr1i3 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP002652 | Human NR1I3 Lentivirus plasmid |
ORF Viral Vector | pGMAP000504 | Human NR1I3 Adenovirus plasmid |
ORF Viral Vector | vGMAD000501 | Human NR1I3 Adenovirus particle |
ORF Viral Vector | vGMAAV000746 | Rat Nr1i3 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP002652 | Human NR1I3 Lentivirus particle |
ORF Viral Vector | vGMAP000504 | Human NR1I3 Adenovirus particle |
Target information
Target ID | GM-T69506 |
Target Name | NR1I3 |
Gene ID | 9970, 12355, 574249, 65035, 101088457, 488653, 493711, 100066015 |
Gene Symbol and Synonyms | CAR,CAR-beta,CAR1,Care2,ESTM32,MB67,NR1I3 |
Uniprot Accession | Q14994 |
Uniprot Entry Name | NR1I3_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000143257 |
Target Classification | Not Available |
This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. In addition to drug metabolism, the CAR protein is also reported to regulate genes involved in glucose metabolism, lipid metabolism, cell proliferation, and circadian clock regulation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.