Human NR1I3/CAR/ CAR1 ORF/cDNA clone-Lentivirus particle (NM_001077482)

Pre-made Human NR1I3/CAR/ CAR1 Lentiviral expression plasmid for NR1I3 lentivirus packaging, NR1I3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to NR1I3/CAR products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002652 Human NR1I3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002652
Gene Name NR1I3
Accession Number NM_001077482
Gene ID 9970
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1074 bp
Gene Alias CAR, CAR1, MB67
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCAGTAGGGAAGATGAGCTGAGGAACTGTGTGGTATGTGGGGACCAAGCCACAGGCTACCACTTTAATGCGCTGACTTGTGAGGGCTGCAAGGGTTTCTTCAGGAGAACAGTCAGCAAAAGCATTGGTCCCACCTGCCCCTTTGCTGGAAGCTGTGAAGTCAGCAAGACTCAGAGGCGCCACTGCCCAGCCTGCAGGTTGCAGAAGTGCTTAGATGCTGGCATGAGGAAAGACATGATACTGTCGGCAGAAGCCCTGGCATTGCGGCGAGCAAAGCAGGCCCAGCGGCGGGCACAGCAAACACCTGTGCAACTGAGTAAGGAGCAAGAAGAGCTGATCCGGACACTCCTGGGGGCCCACACCCGCCACATGGGCACCATGTTTGAACAGTTTGTGCAGTTTAGGCCTCCAGCTCATCTGTTCATCCATCACCAGCCCTTGCCCACCCTGGCCCCTGTGCTGCCTCTGGTCACACACTTCGCAGACATCAACACTTTCATGGTACTGCAAGTCATCAAGTTTACTAAGGACCTGCCCGTCTTCCGTTCCCTGCCCATTGAAGACCAGATCTCCCTTCTCAAGGGAGCAGCTGTGGAAATCTGTCACATCGTACTCAATACCACTTTCTGTCTCCAAACACAAAACTTCCTCTGCGGGCCTCTTCGCTACACAATTGAAGATGGAGCCCGTGTATCTCCCACAGTGGGGTTCCAGGTAGAGTTTTTGGAGTTGCTCTTTCACTTCCATGGAACACTACGAAAACTGCAGCTCCAAGAGCCTGAGTATGTGCTCTTGGCTGCCATGGCCCTCTTCTCTCCTGCTCCCTATCTTACAGACCGACCTGGAGTTACCCAGAGAGATGAGATTGATCAGCTGCAAGAGGAGATGGCACTGACTCTGCAAAGCTACATCAAGGGCCAGCAGCGAAGGCCCCGGGATCGGTTTCTGTATGCGAAGTTGCTAGGCCTGCTGGCTGAGCTCCGGAGCATTAATGAGGCCTACGGGTACCAAATCCAGCACATCCAGGGCCTGTCTGCCATGATGCCGCTGCTCCAGGAGATCTGCAGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T69506-Ab Anti-NR1I3 monoclonal antibody
    Target Antigen GM-Tg-g-T69506-Ag NR1I3 protein
    ORF Viral Vector pGMAD000501 Human NR1I3 Adenovirus plasmid
    ORF Viral Vector pGMAAV000746 Rat Nr1i3 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP002652 Human NR1I3 Lentivirus plasmid
    ORF Viral Vector pGMAP000504 Human NR1I3 Adenovirus plasmid
    ORF Viral Vector vGMAD000501 Human NR1I3 Adenovirus particle
    ORF Viral Vector vGMAAV000746 Rat Nr1i3 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP002652 Human NR1I3 Lentivirus particle
    ORF Viral Vector vGMAP000504 Human NR1I3 Adenovirus particle


    Target information

    Target ID GM-T69506
    Target Name NR1I3
    Gene ID 9970, 12355, 574249, 65035, 101088457, 488653, 493711, 100066015
    Gene Symbol and Synonyms CAR,CAR-beta,CAR1,Care2,ESTM32,MB67,NR1I3
    Uniprot Accession Q14994
    Uniprot Entry Name NR1I3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000143257
    Target Classification Not Available

    This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. In addition to drug metabolism, the CAR protein is also reported to regulate genes involved in glucose metabolism, lipid metabolism, cell proliferation, and circadian clock regulation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.