- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human NR1I3/CAR/ CAR1 ORF/cDNA clone-Adenovirus plasmid (BC069626)
Pre-made Human NR1I3/CAR/ CAR1 adenoviral expression plasmid for NR1I3 adenovirus packaging, NR1I3 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to NR1I3/CAR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
|---|---|---|---|
| pGMAP000504 | Human NR1I3 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
| GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
| High Quality (HQ) Grade | |||
| Seed | 5ug |
Product Description
| Catalog ID | pGMAP000504 |
| Gene Name | NR1I3 |
| Accession Number | BC069626 |
| Gene ID | 9970 |
| Species | Human |
| Product Type | Adenovirus plasmid (overexpression) |
| Insert Length | 1059 bp |
| Gene Alias | CAR, CAR1, MB67, MGC150433, MGC97209 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGCCAGTAGGGAAGATGAGCTGAGGAACTGTGTGGTATGTGGGGACCAAGCCACAGGCTACCACTTTAATGCGCTGACTTGTGAGGGCTGCAAGGGTTTCTTCAGGAGAACAGTCAGCAAAAGCATTGGTCCCACCTGCCCCTTTGCTGGAAGCTGTGAAGTCAGCAAGACTCAGAGGCGCCACTGCCCAGCCTGCAGGTTGCAGAAGTGCTTAGATGCTGGCATGAGGAAAGACATGATACTGTCGGCAGAAGCCCTGGCATTGCGGCGAGCAAAGCAGGCCCAGCGGCGGGCACAGCAAACACCTGTGCAACTGAGTAAGGAGCAAGAAGAGCTGATCCGGACACTCCTGGGGGCCCACACCCGCCACATGGGCACCATGTTTGAACAGTTTGTGCAGTTTAGGCCTCCAGCTCATCTGTTCATCCATCACCAGCCCTTGCCCACCCTGGCCCCTGTGCTGCCTCTGGTCACACACTTCGCAGACATCAACACTTTCATGGTACTGCAAGTCATCAAGTTTACTAAGGACCTGCCTGTCTTCCGTTCCCTGCCCATTGAAGACCAGATCTCCCTTCTCAAGGGAGCAGCTGTGGAAATCTGTCACATCGTACTCAATACCACTTTCTGTCTCCAAACACAAAACTTCCTCTGCGGGCCTCTTCGCTACACAATTGAAGATGGAGCCCGTGTATCTCCCACAGTGGGGTTCCAGGTAGAGTTTTTGGAGTTGCTCTTTCACTTCCATGGAACACTACGAAAACTGCAGCTCCAAGAGCCTGAGTATGTGCTCTTGGCTGCCATGGCCCTCTTCTCTCCTGACCGACCTGGAGTTACCCAGAGAGATGAGATTGATCAGCTGCAAGAGGAGATGGCACTGACTCTGCAAAGCTACATCAAGGGCCAGCAGCGAAGGCCCCGGGATCGGTTTCTGTATGCGAAGTTGCTAGGCCTGCTGGCTGAGCTCCGGAGCATTAATGAGGCCTACGGGTACCAAATCCAGCACATCCAGGGCCTGTCTGCCATGATGCCGCTGCTCCAGGAGATCTGCAGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T69506-Ab | Anti-NR1I3 monoclonal antibody |
| Target Antigen | GM-Tg-g-T69506-Ag | NR1I3 protein |
| ORF Viral Vector | pGMAD000501 | Human NR1I3 Adenovirus plasmid |
| ORF Viral Vector | pGMAAV000746 | Rat Nr1i3 Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMLP002652 | Human NR1I3 Lentivirus plasmid |
| ORF Viral Vector | pGMAP000504 | Human NR1I3 Adenovirus plasmid |
| ORF Viral Vector | vGMAD000501 | Human NR1I3 Adenovirus particle |
| ORF Viral Vector | vGMAAV000746 | Rat Nr1i3 Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMLP002652 | Human NR1I3 Lentivirus particle |
| ORF Viral Vector | vGMAP000504 | Human NR1I3 Adenovirus particle |
Target information
| Target ID | GM-T69506 |
| Target Name | NR1I3 |
| Gene ID | 9970, 12355, 574249, 65035, 101088457, 488653, 493711, 100066015 |
| Gene Symbol and Synonyms | CAR,CAR-beta,CAR1,Care2,ESTM32,MB67,NR1I3 |
| Uniprot Accession | Q14994 |
| Uniprot Entry Name | NR1I3_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000143257 |
| Target Classification | Not Available |
This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. In addition to drug metabolism, the CAR protein is also reported to regulate genes involved in glucose metabolism, lipid metabolism, cell proliferation, and circadian clock regulation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
