Human MAPK14/CSBP/ CSBP1 ORF/cDNA clone-Adenovirus particle (NM_001315.2)
Pre-made Human MAPK14/CSBP/ CSBP1 Adenovirus for MAPK14 overexpression in-vitro and in-vivo. The MAPK14 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MAPK14-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to p38 alpha/MAPK14/CSBP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD000565 | Human MAPK14 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD000565 |
Gene Name | MAPK14 |
Accession Number | NM_001315.2 |
Gene ID | 1432 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1083 bp |
Gene Alias | CSBP, CSBP1, CSBP2, CSPB1, EXIP, Mxi2, p38, p38ALPHA, PRKM14, PRKM15, RK, SAPK2A |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCTCAGGAGAGGCCCACGTTCTACCGGCAGGAGCTGAACAAGACAATCTGGGAGGTGCCCGAGCGTTACCAGAACCTGTCTCCAGTGGGCTCTGGCGCCTATGGCTCTGTGTGTGCTGCTTTTGACACAAAAACGGGGTTACGTGTGGCAGTGAAGAAGCTCTCCAGACCATTTCAGTCCATCATTCATGCGAAAAGAACCTACAGAGAACTGCGGTTACTTAAACATATGAAACATGAAAATGTGATTGGTCTGTTGGACGTTTTTACACCTGCAAGGTCTCTGGAGGAATTCAATGATGTGTATCTGGTGACCCATCTCATGGGGGCAGATCTGAACAACATTGTGAAATGTCAGAAGCTTACAGATGACCATGTTCAGTTCCTTATCTACCAAATTCTCCGAGGTCTAAAGTATATACATTCAGCTGACATAATTCACAGGGACCTAAAACCTAGTAATCTAGCTGTGAATGAAGACTGTGAGCTGAAGATTCTGGATTTTGGACTGGCTCGGCACACAGATGATGAAATGACAGGCTACGTGGCCACTAGGTGGTACAGGGCTCCTGAGATCATGCTGAACTGGATGCATTACAACCAGACAGTTGATATTTGGTCAGTGGGATGCATAATGGCCGAGCTGTTGACTGGAAGAACATTGTTTCCTGGTACAGACCATATTAACCAGCTTCAGCAGATTATGCGTCTGACAGGAACACCCCCCGCTTATCTCATTAACAGGATGCCAAGCCATGAGGCAAGAAACTATATTCAGTCTTTGACTCAGATGCCGAAGATGAACTTTGCGAATGTATTTATTGGTGCCAATCCCCTGGCTGTCGACTTGCTGGAGAAGATGCTTGTATTGGACTCAGATAAGAGAATTACAGCGGCCCAAGCCCTTGCACATGCCTACTTTGCTCAGTACCACGATCCTGATGATGAACCAGTGGCCGATCCTTATGATCAGTCCTTTGAAAGCAGGGACCTCCTTATAGATGAGTGGAAAAGCCTGACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGAGTCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T65864-Ab | Anti-p38 alpha monoclonal antibody |
Target Antigen | GM-Tg-g-T65864-Ag | p38 alpha/MAPK14 protein |
ORF Viral Vector | pGMAD000565 | Human MAPK14 Adenovirus plasmid |
ORF Viral Vector | pGMPC000541 | Human MAPK14 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000408 | Human MAPK14 Adenovirus plasmid |
ORF Viral Vector | pGMLP-SPh-057 | Human MAPK14 Lentivirus plasmid |
ORF Viral Vector | pGMLP-SPh-131 | Human MAPK14 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-197 | Human MAPK14 Adenovirus plasmid |
ORF Viral Vector | pGMAP-SPh-271 | Human MAPK14 Adenovirus plasmid |
ORF Viral Vector | vGMAD000565 | Human MAPK14 Adenovirus particle |
ORF Viral Vector | vGMAP000408 | Human MAPK14 Adenovirus particle |
ORF Viral Vector | vGMLP-SPh-057 | Human MAPK14 Lentivirus particle |
ORF Viral Vector | vGMLP-SPh-131 | Human MAPK14 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-197 | Human MAPK14 Adenovirus particle |
ORF Viral Vector | vGMAP-SPh-271 | Human MAPK14 Adenovirus particle |
Target information
Target ID | GM-T65864 |
Target Name | p38 alpha |
Gene ID | 1432, 26416, 718976, 81649, 101101135, 403856, 534492, 100063532 |
Gene Symbol and Synonyms | Crk1,CSBP,CSBP1,CSBP2,CSPB1,EXIP,Hog,MAPK14,Mxi2,p38,p38-alpha,p38a,p38ALPHA,p38Hog,p38MAPK,PRKM14,PRKM15,RK,SAPK2A |
Uniprot Accession | Q16539 |
Uniprot Entry Name | MK14_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000112062 |
Target Classification | Checkpoint-Immuno Oncology, Kinase |
The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various environmental stresses and proinflammatory cytokines. The activation requires its phosphorylation by MAP kinase kinases (MKKs), or its autophosphorylation triggered by the interaction of MAP3K7IP1/TAB1 protein with this kinase. The substrates of this kinase include transcription regulator ATF2, MEF2C, and MAX, cell cycle regulator CDC25B, and tumor suppressor p53, which suggest the roles of this kinase in stress related transcription and cell cycle regulation, as well as in genotoxic stress response. Four alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.