Human MAPK14/EXIP/ Mxi2 ORF/cDNA clone-Adenovirus particle (BC000092)

Pre-made Human MAPK14/EXIP/ Mxi2 Adenovirus for MAPK14 overexpression in-vitro and in-vivo. The MAPK14 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MAPK14-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to p38 alpha/MAPK14/EXIP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP-SPh-197 Human MAPK14 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP-SPh-197
Gene Name MAPK14
Accession Number BC000092
Gene ID 1432
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1083 bp
Gene Alias EXIP, Mxi2, p38, p38ALPHA, PRKM14, PRKM15, RK, SAPK2A
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCTCAGGAGAGGCCCACGTTCTACCGGCAGGAGCTGAACAAGACAATCTGGGAGGTGCCCGAGCGTTACCAGAACCTGTCTCCAGTGGGCTCTGGCGCCTATGGCTCTGTGTGTGCTGCTTTTGACACAAAAACGGGGTTACGTGTGGCAGTGAAGAAGCTCTCCAGACCATTTCAGTCCATCATTCATGCGAAAAGAACCTACAGAGAACTGCGGTTACTTAAACATATGAAACATGAAAATGTGATTGGTCTGTTGGACGTTTTTACACCTGCAAGGTCTCTGGAGGAATTCAATGATGTGTATCTGGTGACCCATCTCATGGGGGCAGATCTGAACAACATTGTGAAATGTCAGAAGCTTACAGATGACCATGTTCAGTTCCTTATCTACCAAATTCTCCGAGGTCTAAAGTATATACATTCAGCTGACATAATTCACAGGGACCTAAAACCTAGTAATCTAGCTGTGAATGAAGACTGTGAGCTGAAGATTCTGGATTTTGGACTGGCTCGGCACACAGATGATGAAATGACAGGCTACGTGGCCACTAGGTGGTACAGGGCTCCTGAGATCATGCTGAACTGGATGCATTACAACCAGACAGTTGATATTTGGTCAGTGGGATGCATAATGGCCGAGCTGTTGACTGGAAGAACATTGTTTCCTGGTACAGACCATATTGATCAGTTGAAGCTCATTTTAAGACTCGTTGGAACCCCAGGGGCTGAGCTTTTGAAGAAAATCTCCTCAGAGTCTGCAAGAAACTATATTCAGTCTTTGACTCAGATGCCGAAGATGAACTTTGCGAATGTATTTATTGGTGCCAATCCCCTGGCTGTCGACTTGCTGGAGAAGATGCTTGTATTGGACTCAGATAAGAGAATTACAGCGGCCCAAGCCCTTGCACATGCCTACTTTGCTCAGTACCACGATCCTGATGATGAACCAGTGGCCGATCCTTATGATCAGTCCTTTGAAAGCAGGGACCTCCTTATAGATGAGTGGAAAAGCCTGACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGAGTCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T65864-Ab Anti-p38 alpha monoclonal antibody
    Target Antigen GM-Tg-g-T65864-Ag p38 alpha/MAPK14 protein
    ORF Viral Vector pGMAD000565 Human MAPK14 Adenovirus plasmid
    ORF Viral Vector pGMPC000541 Human MAPK14 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000408 Human MAPK14 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-057 Human MAPK14 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-131 Human MAPK14 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-197 Human MAPK14 Adenovirus plasmid
    ORF Viral Vector pGMAP-SPh-271 Human MAPK14 Adenovirus plasmid
    ORF Viral Vector vGMAD000565 Human MAPK14 Adenovirus particle
    ORF Viral Vector vGMAP000408 Human MAPK14 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-057 Human MAPK14 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-131 Human MAPK14 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-197 Human MAPK14 Adenovirus particle
    ORF Viral Vector vGMAP-SPh-271 Human MAPK14 Adenovirus particle


    Target information

    Target ID GM-T65864
    Target Name p38 alpha
    Gene ID 1432, 26416, 718976, 81649, 101101135, 403856, 534492, 100063532
    Gene Symbol and Synonyms Crk1,CSBP,CSBP1,CSBP2,CSPB1,EXIP,Hog,MAPK14,Mxi2,p38,p38-alpha,p38a,p38ALPHA,p38Hog,p38MAPK,PRKM14,PRKM15,RK,SAPK2A
    Uniprot Accession Q16539
    Uniprot Entry Name MK14_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Breast Cancer
    Gene Ensembl ENSG00000112062
    Target Classification Checkpoint-Immuno Oncology, Kinase

    The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various environmental stresses and proinflammatory cytokines. The activation requires its phosphorylation by MAP kinase kinases (MKKs), or its autophosphorylation triggered by the interaction of MAP3K7IP1/TAB1 protein with this kinase. The substrates of this kinase include transcription regulator ATF2, MEF2C, and MAX, cell cycle regulator CDC25B, and tumor suppressor p53, which suggest the roles of this kinase in stress related transcription and cell cycle regulation, as well as in genotoxic stress response. Four alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.