Human CLDN3/C7orf1/CPE-R2 ORF/cDNA clone-Lentivirus particle (NM_001306.3)

Cat. No.: vGMLP000200

Pre-made Human CLDN3/C7orf1/CPE-R2 Lentiviral expression plasmid for CLDN3 lentivirus packaging, CLDN3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CLDN3/C7orf1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000200 Human CLDN3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000200
Gene Name CLDN3
Accession Number NM_001306.3
Gene ID 1365
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 663 bp
Gene Alias C7orf1,CPE-R2,CPETR2,HRVP1,RVP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCCATGGGCCTGGAGATCACGGGCACCGCGCTGGCCGTGCTGGGCTGGCTGGGCACCATCGTGTGCTGCGCGTTGCCCATGTGGCGCGTGTCGGCCTTCATCGGCAGCAACATCATCACGTCGCAGAACATCTGGGAGGGCCTGTGGATGAACTGCGTGGTGCAGAGCACCGGCCAGATGCAGTGCAAGGTGTACGACTCGCTGCTGGCACTGCCACAGGACCTTCAGGCGGCCCGCGCCCTCATCGTGGTGGCCATCCTGCTGGCCGCCTTCGGGCTGCTAGTGGCGCTGGTGGGCGCCCAGTGCACCAACTGCGTGCAGGACGACACGGCCAAGGCCAAGATCACCATCGTGGCAGGCGTGCTGTTCCTTCTCGCCGCCCTGCTCACCCTCGTGCCGGTGTCCTGGTCGGCCAACACCATTATCCGGGACTTCTACAACCCCGTGGTGCCCGAGGCGCAGAAGCGCGAGATGGGCGCGGGCCTGTACGTGGGCTGGGCGGCCGCGGCGCTGCAGCTGCTGGGGGGCGCGCTGCTCTGCTGCTCGTGTCCCCCACGCGAGAAGAAGTACACGGCCACCAAGGTCGTCTACTCCGCGCCGCGCTCCACCGGCCCGGGAGCCAGCCTGGGCACAGGCTACGACCGCAAGGACTACGTCTAA
ORF Protein Sequence MSMGLEITGTALAVLGWLGTIVCCALPMWRVSAFIGSNIITSQNIWEGLWMNCVVQSTGQMQCKVYDSLLALPQDLQAARALIVVAILLAAFGLLVALVGAQCTNCVQDDTAKAKITIVAGVLFLLAALLTLVPVSWSANTIIRDFYNPVVPEAQKREMGAGLYVGWAAAALQLLGGALLCCSCPPREKKYTATKVVYSAPRSTGPGASLGTGYDRKDYV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IO024-Ab Anti-CLD3/ CLDN3/ C7orf1 monoclonal antibody
    Target Antigen GM-Tg-g-IO024-Ag CLDN3 VLP (virus-like particle)
    ORF Viral Vector pGMLP000200 Human CLDN3 Lentivirus plasmid
    ORF Viral Vector vGMLP000200 Human CLDN3 Lentivirus particle


    Target information

    Target ID GM-IO024
    Target Name CLDN3
    Gene ID 1365, 12739, 716771, 65130, 105261291, 403648, 404153, 100059922
    Gene Symbol and Synonyms C7orf1,claudin-3,CLDN3,CPE-R2,CPETR2,HRVP1,mRVP1,RVP1
    Uniprot Accession O15551
    Uniprot Entry Name CLD3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Perinatal necrotizing enterocolitis, ovarian cancer
    Gene Ensembl ENSG00000165215
    Target Classification Checkpoint-Immuno Oncology

    Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this intronless gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. It is also a low-affinity receptor for Clostridium perfringens enterotoxin, and shares aa sequence similarity with a putative apoptosis-related protein found in rat. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.