Human CD1D/CD1A/R3 ORF/cDNA clone-Lentivirus particle (NM_001766)
Cat. No.: vGMLP002053
Pre-made Human CD1D/CD1A/R3 Lentiviral expression plasmid for CD1D lentivirus packaging, CD1D lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
CD1D/CD1A products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP002053 | Human CD1D Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP002053 |
| Gene Name | CD1D |
| Accession Number | NM_001766 |
| Gene ID | 912 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1008 bp |
| Gene Alias | CD1A,R3,R3G1 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGGGTGCCTGCTGTTTCTGCTGCTCTGGGCGCTCCTCCAGGCTTGGGGAAGCGCTGAAGTCCCGCAAAGGCTTTTCCCCCTCCGCTGCCTCCAGATCTCGTCCTTCGCCAATAGCAGCTGGACGCGCACCGACGGCTTGGCGTGGCTGGGGGAGCTGCAGACGCACAGCTGGAGCAACGACTCGGACACCGTCCGCTCTCTGAAGCCTTGGTCCCAGGGCACGTTCAGCGACCAGCAGTGGGAGACGCTGCAGCATATATTTCGGGTTTATCGAAGCAGCTTCACCAGGGACGTGAAGGAATTCGCCAAAATGCTACGCTTATCCTATCCCTTGGAGCTCCAGGTGTCCGCTGGCTGTGAGGTGCACCCTGGGAACGCCTCAAATAACTTCTTCCATGTAGCATTTCAAGGAAAAGATATCCTGAGTTTCCAAGGAACTTCTTGGGAGCCAACCCAAGAGGCCCCACTTTGGGTAAACTTGGCCATTCAAGTGCTCAACCAGGACAAGTGGACGAGGGAAACAGTGCAGTGGCTCCTTAATGGCACCTGCCCCCAATTTGTCAGTGGCCTCCTTGAGTCAGGGAAGTCGGAACTGAAGAAGCAAGTGAAGCCCAAGGCCTGGCTGTCCCGTGGCCCCAGTCCTGGCCCTGGCCGTCTGCTGCTGGTGTGCCATGTCTCAGGATTCTACCCAAAGCCTGTATGGGTGAAGTGGATGCGGGGTGAGCAGGAGCAGCAGGGCACTCAGCCAGGGGACATCCTGCCCAATGCTGACGAGACATGGTATCTCCGAGCAACCCTGGATGTGGTGGCTGGGGAGGCAGCTGGCCTGTCCTGTCGGGTGAAGCACAGCAGTCTAGAGGGCCAGGACATCGTCCTCTACTGGGGTGGGAGCTACACCTCCATGGGCTTGATTGCCTTGGCAGTCCTGGCGTGCTTGCTGTTCCTCCTCATTGTGGGCTTTACCTCCCGGTTTAAGAGGCAAACTTCCTATCAGGGCGTCCTGTGA |
| ORF Protein Sequence | MGCLLFLLLWALLQAWGSAEVPQRLFPLRCLQISSFANSSWTRTDGLAWLGELQTHSWSNDSDTVRSLKPWSQGTFSDQQWETLQHIFRVYRSSFTRDVKEFAKMLRLSYPLELQVSAGCEVHPGNASNNFFHVAFQGKDILSFQGTSWEPTQEAPLWVNLAIQVLNQDKWTRETVQWLLNGTCPQFVSGLLESGKSELKKQVKPKAWLSRGPSPGPGRLLLVCHVSGFYPKPVWVKWMRGEQEQQGTQPGDILPNADETWYLRATLDVVAGEAAGLSCRVKHSSLEGQDIVLYWGGSYTSMGLIALAVLACLLFLLIVGFTSRFKRQTSYQGVL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP0200-Ab | Anti-CD1D/ CD1A/ R3 monoclonal antibody |
| Target Antigen | GM-Tg-g-MP0200-Ag | CD1D VLP (virus-like particle) |
| ORF Viral Vector | pGMLP002053 | Human CD1D Lentivirus plasmid |
| ORF Viral Vector | vGMLP002053 | Human CD1D Lentivirus particle |
Target information
| Target ID | GM-MP0200 |
| Target Name | CD1D |
| Gene ID | 912, 12479, 613268, 25109, 101100784 |
| Gene Symbol and Synonyms | Cd1,CD1.1,CD1A,CD1D,Cd1d1,Ly-38,R3,R3G1 |
| Uniprot Accession | P15813 |
| Uniprot Entry Name | CD1D_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Cancer |
| Gene Ensembl | ENSG00000158473 |
| Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a divergent member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


