Human CD1D/CD1A/R3 ORF/cDNA clone-Lentivirus particle (NM_001766)

Cat. No.: vGMLP002053

Pre-made Human CD1D/CD1A/R3 Lentiviral expression plasmid for CD1D lentivirus packaging, CD1D lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CD1D/CD1A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002053 Human CD1D Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002053
Gene Name CD1D
Accession Number NM_001766
Gene ID 912
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1008 bp
Gene Alias CD1A,R3,R3G1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGTGCCTGCTGTTTCTGCTGCTCTGGGCGCTCCTCCAGGCTTGGGGAAGCGCTGAAGTCCCGCAAAGGCTTTTCCCCCTCCGCTGCCTCCAGATCTCGTCCTTCGCCAATAGCAGCTGGACGCGCACCGACGGCTTGGCGTGGCTGGGGGAGCTGCAGACGCACAGCTGGAGCAACGACTCGGACACCGTCCGCTCTCTGAAGCCTTGGTCCCAGGGCACGTTCAGCGACCAGCAGTGGGAGACGCTGCAGCATATATTTCGGGTTTATCGAAGCAGCTTCACCAGGGACGTGAAGGAATTCGCCAAAATGCTACGCTTATCCTATCCCTTGGAGCTCCAGGTGTCCGCTGGCTGTGAGGTGCACCCTGGGAACGCCTCAAATAACTTCTTCCATGTAGCATTTCAAGGAAAAGATATCCTGAGTTTCCAAGGAACTTCTTGGGAGCCAACCCAAGAGGCCCCACTTTGGGTAAACTTGGCCATTCAAGTGCTCAACCAGGACAAGTGGACGAGGGAAACAGTGCAGTGGCTCCTTAATGGCACCTGCCCCCAATTTGTCAGTGGCCTCCTTGAGTCAGGGAAGTCGGAACTGAAGAAGCAAGTGAAGCCCAAGGCCTGGCTGTCCCGTGGCCCCAGTCCTGGCCCTGGCCGTCTGCTGCTGGTGTGCCATGTCTCAGGATTCTACCCAAAGCCTGTATGGGTGAAGTGGATGCGGGGTGAGCAGGAGCAGCAGGGCACTCAGCCAGGGGACATCCTGCCCAATGCTGACGAGACATGGTATCTCCGAGCAACCCTGGATGTGGTGGCTGGGGAGGCAGCTGGCCTGTCCTGTCGGGTGAAGCACAGCAGTCTAGAGGGCCAGGACATCGTCCTCTACTGGGGTGGGAGCTACACCTCCATGGGCTTGATTGCCTTGGCAGTCCTGGCGTGCTTGCTGTTCCTCCTCATTGTGGGCTTTACCTCCCGGTTTAAGAGGCAAACTTCCTATCAGGGCGTCCTGTGA
ORF Protein Sequence MGCLLFLLLWALLQAWGSAEVPQRLFPLRCLQISSFANSSWTRTDGLAWLGELQTHSWSNDSDTVRSLKPWSQGTFSDQQWETLQHIFRVYRSSFTRDVKEFAKMLRLSYPLELQVSAGCEVHPGNASNNFFHVAFQGKDILSFQGTSWEPTQEAPLWVNLAIQVLNQDKWTRETVQWLLNGTCPQFVSGLLESGKSELKKQVKPKAWLSRGPSPGPGRLLLVCHVSGFYPKPVWVKWMRGEQEQQGTQPGDILPNADETWYLRATLDVVAGEAAGLSCRVKHSSLEGQDIVLYWGGSYTSMGLIALAVLACLLFLLIVGFTSRFKRQTSYQGVL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0200-Ab Anti-CD1D/ CD1A/ R3 monoclonal antibody
    Target Antigen GM-Tg-g-MP0200-Ag CD1D VLP (virus-like particle)
    ORF Viral Vector pGMLP002053 Human CD1D Lentivirus plasmid
    ORF Viral Vector vGMLP002053 Human CD1D Lentivirus particle


    Target information

    Target ID GM-MP0200
    Target Name CD1D
    Gene ID 912, 12479, 613268, 25109, 101100784
    Gene Symbol and Synonyms Cd1,CD1.1,CD1A,CD1D,Cd1d1,Ly-38,R3,R3G1
    Uniprot Accession P15813
    Uniprot Entry Name CD1D_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000158473
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a divergent member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.