2019 nCoV (SARS2 coronavirus) ORF6 pcDNA3.1(+) vector
Cat No.: GMV-V-2019nCoV-013
Order informatioin
Delivery impact due to the Coronavirus Outbreak
With the COVID-19 outbreak in the world, many flights have been cancelled. In order for the customer to receive the goods properly, we use the FedEx Customized Freight (FCF) of Fedex which demands a higher fee. If the delivery fee is more expensive in your area, we will contact you by mail.
Package | Catalog No. | Price(In USD) | Qty (Quantity) | Sum(In USD) |
---|---|---|---|---|
5ug | GMV-V-2019nCoV-013 | 828 | ||
Shipping Cost: | 760.00 | |||
Total: | ||||
Description
2019 nCoV related Gene | ORF6 |
Species Host | 2019 nCoV |
Vector | pcDNA3.1(+) |
Reporter | null |
Antibiotic in Mammalian cell | Neomycin / G418 |
Length | 186 |
Promoter | CMV |
Tag | No tag |
Codon Optimized | No |
Gene Accession Number | LC528233.1 |
Application | Mammalian cells expression |
Sequence | ATGTTTCATCTCGTTGACTTTCAGGTTACTATAGCAGAGATATTACTAATTATTATGAGGACTTTTAAAGTTTCCATTTGGAATCTTGATTACATCATAAACCTCATAATTAAAAATTTATCTAAGTCACTAACTGAGAATAAATATTCTCAATTAGATGAAGAGCAACCAATGGAGATTGATTAA |
- GENEMEDI
- 6th Floor, Buiding No.2, Kangxin Road 3377, Shanghai, China
- Email: [email protected] [email protected]
- Telephone: +86-21-50478399 Fax: 86-21-50478399
- Privacy Policy
- TECHNICAL SUPPORT
- Product FAQs
- Technical manuals
- Publications
- Email: [email protected]
