Order informatioin


Delivery impact due to the Coronavirus Outbreak

With the COVID-19 outbreak in the world, many flights have been cancelled. In order for the customer to receive the goods properly, we use the FedEx Customized Freight (FCF) of Fedex which demands a higher fee. If the delivery fee is more expensive in your area, we will contact you by mail.

Package Catalog No. Price(In USD) Qty (Quantity) Sum(In USD)
5ug GMV-V-2019nCoV-034 828
Shipping Cost: 760.00
Total:



Description

2019 nCoV related GeneORF10
Species Host2019 nCoV
VectorpET21a
Reporternull
Antibiotic in Mammalian cellNone
Length117
PromoterT7
TagC-His
Coden Optimizedcoden optimized for E.coli
Gene Accession NumberLC528232.1
ApplicationE.coli expression, recombinant protein production
SequenceATGGGCTATATTAATGTGTTTGCATTTCCGTTTACCATTTATAGTCTGCTGCTGTGTCGTATGAACTCTCGCAATTATATTGCACAGGTGGATGTTGTGAATTTTAATCTGACC




GENEMEDI
6th Floor, Buiding No.2, Kangxin Road 3377, Shanghai, China
Email: [email protected] [email protected]
Telephone: +86-21-50478399   Fax: 86-21-50478399
Privacy Policy
Chinese Website

COVID-19
related
protocols,
data and
products

COVID-19 related protocols, data and products

×