2019 nCoV (SARS2 coronavirus) ORF10 pET21a vector
Cat No.: GMV-V-2019nCoV-034
Order informatioin
Delivery impact due to the Coronavirus Outbreak
With the COVID-19 outbreak in the world, many flights have been cancelled. In order for the customer to receive the goods properly, we use the FedEx Customized Freight (FCF) of Fedex which demands a higher fee. If the delivery fee is more expensive in your area, we will contact you by mail.
Package | Catalog No. | Price(In USD) | Qty (Quantity) | Sum(In USD) |
---|---|---|---|---|
5ug | GMV-V-2019nCoV-034 | 828 | ||
Shipping Cost: | 760.00 | |||
Total: | ||||
Description
2019 nCoV related Gene | ORF10 |
Species Host | 2019 nCoV |
Vector | pET21a |
Reporter | null |
Antibiotic in Mammalian cell | None |
Length | 117 |
Promoter | T7 |
Tag | C-His |
Coden Optimized | coden optimized for E.coli |
Gene Accession Number | LC528232.1 |
Application | E.coli expression, recombinant protein production |
Sequence | ATGGGCTATATTAATGTGTTTGCATTTCCGTTTACCATTTATAGTCTGCTGCTGTGTCGTATGAACTCTCGCAATTATATTGCACAGGTGGATGTTGTGAATTTTAATCTGACC |
- GENEMEDI
- 6th Floor, Buiding No.2, Kangxin Road 3377, Shanghai, China
- Email: [email protected] [email protected]
- Telephone: +86-21-50478399 Fax: 86-21-50478399
- Privacy Policy
- TECHNICAL SUPPORT
- Product FAQs
- Technical manuals
- Publications
- Email: [email protected]
