Order informatioin

Delivery impact due to the Coronavirus Outbreak

With the COVID-19 outbreak in the world, many flights have been cancelled. In order for the customer to receive the goods properly, we use the FedEx Customized Freight (FCF) of Fedex which demands a higher fee. If the delivery fee is more expensive in your area, we will contact you by mail.

Package Catalog No. Price(In USD) Qty (Quantity) Sum(In USD)
5ug GMV-V-2019nCoV-051 1690
Shipping Cost: 760.00


2019 nCoV related Gene Spike(S1+S2)
Species Host 2019 nCoV
VectorLentiviral vector
Antibiotic in Mammalian cell Puromycin
Coden Optimizedcoden optimized for mamamlian
Gene Accession NumberQHD43416.1
ApplicationLentivirus production;
Lentivirus-based 2019nCoV vaccine
Mammalian cells expression
Sequence atgtttgtttttcttgttttattgccactagtctctagtcagtgtgttaatcttacaaccagaactcaattaccccctgcatacactaattctttcacacgtggtgtttattaccctgacaaagttttcagatcctcagttttacattcaactcaggacttgttcttacctttcttttccaatgttacttggttccatgctatacatgtctctgggaccaatggtactaagaggtttgataaccctgtcctaccatttaatgatggtgtttattttgcttccactgagaagtctaacataataagaggctggatttttggtactactttagattcgaagacccagtccctacttattgttaataacgctactaatgttgttattaaagtctgtgaatttcaattttgtaatgatccatttttgggtgtttattaccacaaaaacaacaaaagttggatggaaagtgagttcagagtttattctagtgcgaataattgcacttttgaatatgtctctcagccttttcttatggaccttgaaggaaaacagggtaatttcaaaaatcttagggaatttgtgtttaagaatattgatggttattttaaaatatattctaagcacacgcctattaatttagtgcgtgatctccctcagggtttttcggctttagaaccattggtagatttgccaataggtattaacatcactaggtttcaaactttacttgctttacatagaagttatttgactcctggtgattcttcttcaggttggacagctggtgctgcagcttattatgtgggttatcttcaacctaggacttttctattaaaatataatgaaaatggaaccattacagatgctgtagactgtgcacttgaccctctctcagaaacaaagtgtacgttgaaatccttcactgtagaaaaaggaatctatcaaacttctaactttagagtccaaccaacagaatctattgttagatttcctaatattacaaacttgtgcccttttggtgaagtttttaacgccaccagatttgcatctgtttatgcttggaacaggaagagaatcagcaactgtgttgctgattattctgtcctatataattccgcatcattttccacttttaagtgttatggagtgtctcctactaaattaaatgatctctgctttactaatgtctatgcagattcatttgtaattagaggtgatgaagtcagacaaatcgctccagggcaaactggaaagattgctgattataattataaattaccagatgattttacaggctgcgttatagcttggaattctaacaatcttgattctaaggttggtggtaattataattacctgtatagattgtttaggaagtctaatctcaaaccttttgagagagatatttcaactgaaatctatcaggccggtagcacaccttgtaatggtgttgaaggttttaattgttactttcctttacaatcatatggtttccaacccactaatggtgttggttaccaaccatacagagtagtagtactttcttttgaacttctacatgcaccagcaactgtttgtggacctaaaaagtctactaatttggttaaaaacaaatgtgtcaatttcaacttcaatggtttaacaggcacaggtgttcttactgagtctaacaaaaagtttctgcctttccaacaatttggcagagacattgctgacactactgatgctgtccgtgatccacagacacttgagattcttgacattacaccatgttcttttggtggtgtcagtgttataacaccaggaacaaatacttctaaccaggttgctgttctttatcaggatgttaactgcacagaagtccctgttgctattcatgcagatcaacttactcctacttggcgtgtttattctacaggttctaatgtttttcaaacacgtgcaggctgtttaataggggctgaacatgtcaacaactcatatgagtgtgacatacccattggtgcaggtatatgcgctagttatcagactcagactaattctcctcggcgggcacgtagtgtagctagtcaatccatcattgcctacactatgtcacttggtgcagaaaattcagttgcttactctaataactctattgccatacccacaaattttactattagtgttaccacagaaattctaccagtgtctatgaccaagacatcagtagattgtacaatgtacatttgtggtgattcaactgaatgcagcaatcttttgttgcaatatggcagtttttgtacacaattaaaccgtgctttaactggaatagctgttgaacaagacaaaaacacccaagaagtttttgcacaagtcaaacaaatttacaaaacaccaccaattaaagattttggtggttttaatttttcacaaatattaccagatccatcaaaaccaagcaagaggtcatttattgaagatctacttttcaacaaagtgacacttgcagatgctggcttcatcaaacaatatggtgattgccttggtgatattgctgctagagacctcatttgtgcacaaaagtttaacggccttactgttttgccacctttgctcacagatgaaatgattgctcaatacacttctgcactgttagcgggtacaatcacttctggttggacctttggtgcaggtgctgcattacaaataccatttgctatgcaaatggcttataggtttaatggtattggagttacacagaatgttctctatgagaaccaaaaattgattgccaaccaatttaatagtgctattggcaaaattcaagactcactttcttccacagcaagtgcacttggaaaacttcaagatgtggtcaaccaaaatgcacaagctttaaacacgcttgttaaacaacttagctccaattttggtgcaatttcaagtgttttaaatgatatcctttcacgtcttgacaaagttgaggctgaagtgcaaattgataggttgatcacaggcagacttcaaagtttgcagacatatgtgactcaacaattaattagagctgcagaaatcagagcttctgctaatcttgctgctactaaaatgtcagagtgtgtacttggacaatcaaaaagagttgatttttgtggaaagggctatcatcttatgtccttccctcagtcagcacctcatggtgtagtcttcttgcatgtgacttatgtccctgcacaagaaaagaacttcacaactgctcctgccatttgtcatgatggaaaagcacactttcctcgtgaaggtgtctttgtttcaaatggcacacactggtttgtaacacaaaggaatttttatgaaccacaaatcattactacagacaacacatttgtgtctggtaactgtgatgttgtaataggaattgtcaacaacacagtttatgatcctttgcaacctgaattagactcattcaaggaggagttagataaatattttaagaatcatacatcaccagatgttgatttaggtgacatctctggcattaatgcttcagttgtaaacattcaaaaagaaattgaccgcctcaatgaggttgccaagaatttaaatgaatctctcatcgatctccaagaacttggaaagtatgagcagtatataaaatggccatggtacatttggctaggttttatagctggcttgattgccatagtaatggtgacaattatgctttgctgtatgaccagttgctgtagttgtctcaagggctgttgttcttgtggatcctgctgcaaatttgatgaagacgactctgagccagtgctcaaaggagtcaaattacattacacataa

Pre-made gene ORF plasmids for 2019 nCoV (SARS CoV-2 coronavirus, COVID-19)
Spike protein(S protein):Spike full length, Spike RBD,Spike mutation(D614G mutataion,
S943P,V367F, G476S, V483A, H49Y, Q239K, A831V, P1263L, D839Y/N/E,D839Y, D839N, D839E

Cat No. 2019 nCoV
related Gene
Gene &Vector description of 2019 nCoV Vector Reporter Tag Coden
GMV-V-2019nCoV-051 Spike(S1+S2) pGMLV-2019nCoV-spike (S1+S2,C-6His) Lentiviral vector Zsgreen C-6His coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-001 Spike(S1+S2) pGMLV-2019nCoV-spike(S1+S2,C-6His) Lentiviral vector Zsgreen C-6His No Picture loading failed.
GMV-V-2019nCoV-017 Spike(S1+S2) pGM-2019nCoV-spike protein (S protein,S1+S2) pcDNA3.1(+) null No tag No Picture loading failed.
GMV-V-2019nCoV-008Picture loading failed. Spike(S1+S2) pGM-2019nCoV-spike protein (S protein,S1+S2) pcDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-053Picture loading failed. Spike(S1+S2) Ad-2019nCoV-Spike(S1+S2,C-3FLAG) Pre-made adenovirus null C-3FLAG coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-047 Spike(S1+S2) Ad-2019nCoV-Spike(S1+S2,C-3FLAG) Pre-made adenovirus EGFP C-3FLAG No Picture loading failed.
GMV-V-2019nCoV-052Picture loading failed. Spike(S1+S2) pGMAD-2019nCoV-spike (S protein,S1+S2,C-3FLAG) Adenoviral vector null C-3FLAG coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-004 Spike(S1+S2) pGMAD-2019nCoV-spike (S protein,S1+S2,C-3FLAG) Adenoviral vector EGFP C-3FLAG No Picture loading failed.
GMV-V-2019nCoV-035 Spike(S1+S2) pGM-2019nCoV-spike protein (S protein, S1+S2) pET21a null C-His coden optimized for E.coli Picture loading failed.
GMV-V-2019nCoV-037 Spike(S1+S2) pGM-2019nCoV-spike protein (S protein, S1+S2) pET-28a(+) null His No Picture loading failed.
GMV-V-2019nCoV-002 Spike(S1) pGMLV-2019nCoV-S1(C-6His) Lentiviral vector Zsgreen C-6His No Picture loading failed.
GMV-V-2019nCoV-005 Spike(S1) pGMAD-2019nCoV-S1(C-3FLAG) Adenoviral vector EGFP C-3FLAG No Picture loading failed.
GMV-V-2019nCoV-048 Spike(S1) Ad-2019nCoV-Spike(S1 protein, C-3FLAG) Pre-made adenovirus EGFP C-3FLAG No Picture loading failed.
GMV-V-2019nCoV-003 Spike RBD pGMLV-2019nCoV-Spike RBD(C-6His) Lentiviral vector Zsgreen C-6His No Picture loading failed.
GMV-V-2019nCoV-007 Spike RBD pGMAAV-2019nCoV-Spike RBD(C-3FLAG) AAV vector Zsgreen C-3FLAG No Picture loading failed.
GMV-V-2019nCoV-050 Spike RBD AAV-2019nCoV-Spike (S protein RBD, C-3FLAG) Pre-made AAV Zsgreen C-3FLAG No Picture loading failed.
GMV-V-2019nCoV-006 Spike RBD pGMAD-2019nCoV-Spike RBD(C-3FLAG) Adenoviral vector EGFP C-3FLAG No Picture loading failed.
GMV-V-2019nCoV-049 Spike RBD Ad-2019nCoV-Spike(S protein RBD, C-3FLAG) Pre-made adenovirus EGFP C-3FLAG No Picture loading failed.
GMV-V-2019nCoV-054Picture loading failed. Spike(S1+S2) D614G mutation pGM-2019nCoV-spike D614G protein (S protein,S1+S2,D614G) pcDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-055Picture loading failed. Spike(S1+S2) D614G mutation pGMAD-2019nCoV-spike D614G (S protein,S1+S2,D614G) Adenoviral vector null C-3FLAG coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-056Picture loading failed. Spike(S1+S2) D614G mutation Ad-2019nCoV-Spike D614G (S protein,S1+S2,D614G) Pre-made adenovirus null C-3FLAG coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-057 Spike(S1+S2) S943P mutation pGM-2019nCoV-spike S943P protein (S protein,S1+S2,S943P) pcDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-058 Spike(S1+S2) V367F mutation pGM-2019nCoV-spike V367F protein (S protein,S1+S2,V367F) pcDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-059 Spike(S1+S2) G476S mutation pGM-2019nCoV-spike G476S protein (S protein,S1+S2,G476S) pcDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-060 Spike(S1+S2) V483A pGM-2019nCoV-spike V483A protein (S protein,S1+S2,V483A) pcDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-061 Spike(S1+S2)H49Y mutation pGM-2019nCoV-spike H49Y protein (S protein,S1+S2,H49Y) pcDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-062 Spike(S1+S2) Q239K mutation pGM-2019nCoV-spike Q239K protein (S protein,S1+S2,Q239K) pcDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-063 Spike(S1+S2) A831V mutation pGM-2019nCoV-spike A831V protein (S protein,S1+S2,A831V) pcDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-064 Spike(S1+S2) P1263L mutation pGM-2019nCoV-spike P1263L protein (S protein,S1+S2,P1263L) pcDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-065 Spike(S1+S2) D839Y/N/E-D839Y mutation pGM-2019nCoV-spike D839Y/N/E-D839Y protein (S protein,S1+S2,D839Y/N/E-D839Y) pcDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-066 Spike(S1+S2) D839Y/N/E-D839N mutation pGM-2019nCoV-spike D839Y/N/E-D839N  protein (S protein,S1+S2,D839Y/N/E-D839N ) pcDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-067 Spike(S1+S2) D839Y/N/E-D839E mutation pGM-2019nCoV-spike D839Y/N/E-D839E protein (S protein,S1+S2,D839Y/N/E-D839E) pcDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.

2019 nCoV (SARS2 coronavirus) gene and vectors

Cat No. 2019 nCoV
related Gene
Gene &Vector description of 2019 nCoV Vector Reporter Tag Coden
GMV-V-2019nCoV-015 ORF8 pGM-2019nCoV-ORF8 pcDNA3.1(+) null No tag No Picture loading failed.
GMV-V-2019nCoV-024 ORF8 pGM-H2019nCoV-ORF8 pCDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-033 ORF8 pGM-E2019nCoV-ORF8 pET21a null C-His coden optimized for E.coli Picture loading failed.
GMV-V-2019nCoV-014 ORF7 pGM-2019nCoV-ORF7a pcDNA3.1(+) null No tag No Picture loading failed.
GMV-V-2019nCoV-023 ORF7 pGM-H2019nCoV-ORF7a pCDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-032 ORF7 pGM-E2019nCoV-ORF7a pET21a null C-His coden optimized for E.coli Picture loading failed.
GMV-V-2019nCoV-013 ORF6 pGM-2019nCoV-ORF6 pcDNA3.1(+) null No tag No Picture loading failed.
GMV-V-2019nCoV-022 ORF6 pGM-H2019nCoV-ORF6 pCDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-031 ORF6 pGM-E2019nCoV-ORF6 pET21a null C-His coden optimized for E.coli Picture loading failed.
GMV-V-2019nCoV-012 ORF3a pGM-2019nCoV-ORF3a pcDNA3.1(+) null No tag No Picture loading failed.
GMV-V-2019nCoV-021 ORF3a pGM-H2019nCoV-ORF3a pCDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-030 ORF3a pGM-E2019nCoV-ORF3a pET21a null C-His coden optimized for E.coli Picture loading failed.
GMV-V-2019nCoV-016 ORF10 pGM-2019nCoV-ORF10 pcDNA3.1(+) null No tag No Picture loading failed.
GMV-V-2019nCoV-025 ORF10 pGM-H2019nCoV-ORF10 pCDNA3.1(+) null No tag coden optimized or mamamlian Picture loading failed.
GMV-V-2019nCoV-034 ORF10 pGM-E2019nCoV-ORF10 pET21a null C-His coden optimized for E.coli Picture loading failed.
GMV-V-2019nCoV-011 N protein pGM-2019nCoV-Nucleocapsid Protein (N protein) pcDNA3.1(+) null No tag No Picture loading failed.
GMV-V-2019nCoV-020 N protein pGM-2019nCoV-Nucleocapsid Protein (N protein) pCDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-029 N protein pGM-2019nCoV-Nucleocapsid Protein (N protein) pET21a null C-His coden optimized for E.coli Picture loading failed.
GMV-V-2019nCoV-010 M protein pGM-2019nCoV-Membrane protein (M protein) pcDNA3.1(+) null No tag No Picture loading failed.
GMV-V-2019nCoV-019 M protein pGM-2019nCoV-Membrane protein (M protein) pCDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-028 M protein pGM-2019nCoV-Membrane protein (M protein) pET21a null C-His coden optimized for E.coli Picture loading failed.
GMV-V-2019nCoV-009 E protein pGM-2019nCoV-Envelope Protein (E protein) pcDNA3.1(+) null No tag No Picture loading failed.
GMV-V-2019nCoV-018 E protein pGM-2019nCoV-Envelope Protein (E protein) pCDNA3.1(+) null No tag coden optimized for mamamlian Picture loading failed.
GMV-V-2019nCoV-027 E protein pGM-2019nCoV-Envelope Protein (E protein) pET21a null C-His coden optimized for E.coli Picture loading failed.
GMV-V-2019nCoV-045 TMPRSS2 pGMLv-hTMPRSS2(C-3FLAG) Lentiviral vector Zsgreen C-3FLAG No Picture loading failed.
GMV-V-2019nCoV-041 ACE2 pGMLV-hACE2(C-3FLAG) Lentiviral vector Zsgreen C-3FLAG No Picture loading failed.
GMV-V-2019nCoV-042 ACE2 pAD-hACE2(C-3FLAG) Pre-made Adenovirus EGFP C-3FLAG No Picture loading failed.
GMV-V-2019nCoV-046 TMPRSS2 pGMLv-mtmprss2(C-3FLAG) Lentiviral vector Zsgreen C-3FLAG No Picture loading failed.
GMV-V-2019nCoV-043 ACE2 pAD-mACE2(C-3FLAG) Pre-made Adenovirus EGFP C-3FLAG No Picture loading failed.
GMV-V-2019nCoV-044 ACE2 pGMLV-mACE2(C-3FLAG) Lentiviral vector Zsgreen C-3FLAG No Picture loading failed.

About SARS-CoV-2 (2019nCoV, novel Coronavirus) Spike protein, S1 Protein, Spike S1-NTD, Spike S1-CTD, Spike-RBD and Spike trimer protein.

1. SARS-CoV-2 (2019nCoV) Spike protein: SARS-CoV-2, a newly emerged pathogen spreading worldwide. The transmembrane spike (S) glycoprotein of SARS-CoV-2 that forms homotrimers protruding from the viral surface is known to mediate coronavirus entry into host cells. It has been reported that spike protein can bind with high affinity to human ACE2 and uses it as an entry receptor to invade target cells.

2. SARS-CoV-2 (2019nCoV) spike S1 protein: The spike protein is a large type I transmembrane glycoprotein comprises two functional subunits, S1 and S2. S1 subunit of spike protein is responsible for binding to the host cell receptor. S2 subunit is responsible for fusion of the viral and cellular membranes.

3. SARS-CoV-2 (2019nCoV) spike S1-NTD and S1-CTD: For most coronaviruses, the N-terminal domain (NTD) of the S1 subunit attaches to cellular carbohydrates and the C-terminal domain of S1 (S1-CTD) binds to a cellular protein receptor. Carbohydrate binding by the S1 N-terminal domain is thought to keep the virus in close proximity to the host cell surface, whereas engagement of specific protein receptors by the S1-CTD is thought to initiate a series of conformational changes in the spike that ultimately result in membrane fusion and delivery of the viral genome to the cytosol.

4. SARS-CoV-2 (2019nCoV) Spike RBD: S1 subunit of spike protein contains a receptor binding domain (RBD), which is responsible for recognizing the cell surface receptor.

5. SARS-CoV-2 (2019nCoV) Spike trimer protein: The transmembrane spike (S) glycoprotein of SARS-CoV-2 usually forms homotrimers protruding from the viral surface. S trimers are extensively decorated with N-linked glycans that are important for proper folding and for modulating accessibility to host proteases and neutralizing Abs. It has been found that S glycoprotein trimers in highly pathogenic human coronaviruses appear to exist in partially opened states, while they remain largely closed in human coronaviruses associated with common colds.

About SARS-CoV-2 (2019nCoV, novel Coronavirus) Envelop protein (Coronavirus E protein)

1. SARS-CoV-2 (2019nCoV) E protein: E protein is the smallest major structural proteins. It has a N-terminal ectodomain and a C-terminal endodomain with ion channel activity. During the replication cycle, E protein is abundantly expressed inside the infected cell, but only a small portion is incorporated into the virus envelope. The majority of the protein participates in viral assembly and budding. E protein is important in virus production and maturation. Recombinant CoVs without E have been shown to exhibit significantly reduced viral titres, crippled viral maturation, or yield incompetent progeny.

About SARS-CoV-2 (2019nCoV, novel Coronavirus) membrane protein (Coronavirus M protein)

1. SARS-CoV-2 (2019nCoV) M protein: Coronavirus M protein is believed to define the shape of the viral envelope,which contains three transmembrane domains. It has a small N-terminal glycosylated ectodomain and a much larger C-terminal endodomain that extends 6–8 nm into the viral particle. M protein usualy exists as a dimer, and may adopt two different conformations allowing it to promote membrane curvature as well as bind to the nucleocapsid.

About SARS-CoV-2 (2019nCoV, novel Coronavirus) Nucleocapsid protein (Coronavirus N protein)

1. SARS-CoV-2 (2019nCoV) N protein: Coronavirus N protein is required for coronavirus RNA synthesis, and has RNA chaperone activity that may be involved in template switch. Nucleocapsid protein is a most abundant protein of coronavirus. N protein packages the positive strand viral genome RNA into a helical ribonucleocapsid (RNP) and plays a fundamental role during virion assembly through its interactions with the viral genome and membrane protein M. Plays an important role in enhancing the efficiency of subgenomic viral RNA transcription as well as viral replication. Because of the conservation of N protein sequence and its strong immunogenicity, the N protein of coronavirus is chosen as a diagnostic tool.

About SARS-CoV-2 (2019nCoV, novel Coronavirus)Non-structure protein (Nsp1-Nsp16)

2019nCoV contains 16 Non-structure protein (Nsp1-Nsp16) that may be drugable targets for antiviral compounds discovery against COVID-191.

Non-structure protein(NSP)information of SARS-CoV-2 (2019nCoV)1
Non-structure proteins Starting position (aa) Ending position (aa) Length (aa)
nsp1 1 180 180
(leader protein)
nsp2 181 818 638
nsp3 819 2763 1945
(Papain-Like proteinase, PLpro)
nsp4 2764 3263 500
nsp5 3264 3569 306
(Mpro, Main proteinase, 3C-like proteinase)
nsp10 4254 4392 139
(growth-factor-like protein)
(RdRP,NA-dependent RNA polymerase)
(RNA 5'-triphosphatase)
(3'-to-5' exonuclease)
(2’O-MTase, 2'-O-ribose methyltransferase)

1. Nsp3: Nsp3 (200 kDa) is the largest protein encoded by the coronavirus (CoV) genome. Nsp3 is an essential component of the replication and transcription complex. It comprises various domains, the organization of which differs between CoV genera, due to duplication or absence of some domains. However, the N-terminal region of the Nsp3 is highly conserved among CoV, containing a ubiquitin-like (Ubl) globular fold followed by a flexible, extended acidic-domain (AC domain) rich in glutamic acid (38%). Next to the AC domain is a catalytically active ADP-ribose-1"-phosphatase (ADRP, app-1"-pase) domain (also called macro domain or X domain) thought to play a role during synthesis of viral subgenomic RNAs. SARS Unique Domain (SUD), a domain not yet identified in other coronaviruses from alphacoronavirus and betacoronavirus, follows next. The SUD domain binds oligonucleotides known to form G-quadruplexes. Downstream of the SUD domain is a second Ubl domain and the catalytically active PLpro domain that proteolytically processes the Nsp1/2, Nsp2/3 and Nsp3/4 cleavage sites. Downstream of PLpro are found a nucleic acid-binding domain (NAB) with a nucleic acid chaperon function, which is conserved in betacoronavirus and gammacoronavirus, and one uncharacterized domain termed the marker domain (G2M). Following the G2M are two predicted double-pass transmembrane domains (TM1–2 and TM3–4), a putative metal binding region (ZN) and the Y domain of unknown function (subdomains Y1–3).

2. Nsp5: Nsp5 protease (3CLpro; Mpro) mediates processing at 11 distinct cleavage sites, including its own autoproteolysis, and is essential for virus replication. Nsp5 exhibits a conserved three-domain structure and catalytic residues.

3. Nsp10: Nsp10 (18 kDa) is well conserved among coronaviruses and encoded by ORF1a. It's thought to serve as an important multifunctional cofactor in replication. Nsp10 was shown to interact with itself, as well as with Nsp1, Nsp7, Nsp14, and Nsp16. The important role of Nsp10 is responsible for RNA synthesis. It was shown that a murine hepatitis virus (MHV) temperature-sensitive mutant carrying a non-synonymous mutation in the Nsp10 coding sequence had a defect in minus-strand RNA synthesis at non-permissive temperatures.

4. Nsp12: Nsp12 (102 kDa) is a multidomain RNA polymerase, which is the most conserved protein in coronaviruses. Nsp12 contains an RNA-dependent RNA polymerase (RdRp) domain in its C-terminal, which is essential for the viral replication and transcription.

5. Nsp16: Nsp16 is an SAM-dependent nucleoside-2’O-methyl-transferase (2’O-MTase). The mRNA cap for coronaviruses is completed by Nsp16, which ensures formation of a protective cap-1 structure that prevent recognition by either MDA5 or IFIT proteins. Finally, the NSP16/NSP10 complex finishes coronavirus capping process permitting viral infection with reduced host recognition.

About COVID-19 pandemic, Coronavirus (Coronavirus) and genome of SARS-CoV-2 (2019nCoV)

COVID-19 pandemic is caused by 2019nCoV (SARS-CoV-2, a novel coronavirus) infection.The 2019-nCoV genome was annotated to possess 14 ORFs encoding 27 proteins1.

Picture loading failed.
Figure. Schematic representative of genome structure and encoded gene of SARS-CoV-2 (2019nCoV)1

Table.Genome Annotation of 2019-nCoV1
Gene name of 2019nCoV (SARS-CoV-2, a novel coronavirus) Coding region(nt) Protein length(aa)
orf1ab266-13468, 13468-215557096
E (envelope protei)26245-2647275
M (matrix protein)26523-27191222

Collection of COVID-19 landscape knowledge base

Viral vector-based vaccine; DNA-based vaccine; RNA based vaccine - A landscape for vaccine technology against infectious disease, COVID-19 and tumor.

COVID-19 landscape Knowledge Base

An Insight of comparison between COVID-19 (2019-nCoV disease) and SARS in pathology and pathogenesis

Landscape Coronavirus Disease 2019 test (COVID-19 test) in vitro -- A comparison of PCR vs Immunoassay vs Crispr-Based test


1. Wu, A. et al. Genome Composition and Divergence of the Novel Coronavirus (2019-nCoV) Originating in China. Cell Host Microbe, doi:10.1016/j.chom.2020.02.001 (2020).