Human CABP5 ORF/cDNA clone-Adenovirus plasmid (BC126133)

Pre-made Human CABP5/ adenoviral expression plasmid for CABP5 adenovirus packaging, CABP5 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000497 Human CABP5 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000497
Gene Name CABP5
Accession Number BC126133
Gene ID 56344
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 522 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGTTCCCCATGGGCCCCGCCTGCATCTTCTTGAGGAAAGGCATTGCTGAGAAACAGCGGGAAAGACCACTGGGACAAGATGAGATTGAAGAGCTGCGGGAAGCATTTCTTGAGTTCGATAAGGACCGAGATGGGTTCATCTCTTGTAAGGATCTGGGGAATCTCATGAGGACGATGGGTTACATGCCCACGGAGATGGAACTGATTGAGCTCGGCCAGCAAATCCGCATGAACTTGGGTGGCCGTGTAGACTTTGATGACTTTGTGGAGCTGATGACCCCCAAATTGCTTGCAGAAACAGCTGGGATGATCGGTGTCCAGGAGATGCGGGATGCCTTCAAGGAGTTTGACACGAATGGAGATGGGGAGATCACCCTGGTGGAGCTACAGCAGGCCATGCAGAGACTCCTGGGGGAGCGGCTCACCCCCCGGGAGATCTCTGAGGTTGTCCGGGAGGCTGATGTTAATGGAGACGGCACAGTTGACTTTGAAGAGTTTGTGAAGATGATGTCTCGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    ORF Viral Vector vGMAP000497 Human CABP5 Adenovirus particle




    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.