Human CABP5 ORF/cDNA clone-Adenovirus plasmid (BC126133)
Pre-made Human CABP5/ adenoviral expression plasmid for CABP5 adenovirus packaging, CABP5 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000501 | Human CABP5 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000501 |
Gene Name | CABP5 |
Accession Number | BC126133 |
Gene ID | 56344 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 522 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCAGTTCCCCATGGGCCCCGCCTGCATCTTCTTGAGGAAAGGCATTGCTGAGAAACAGCGGGAAAGACCACTGGGACAAGATGAGATTGAAGAGCTGCGGGAAGCATTTCTTGAGTTCGATAAGGACCGAGATGGGTTCATCTCTTGTAAGGATCTGGGGAATCTCATGAGGACGATGGGTTACATGCCCACGGAGATGGAACTGATTGAGCTCGGCCAGCAAATCCGCATGAACTTGGGTGGCCGTGTAGACTTTGATGACTTTGTGGAGCTGATGACCCCCAAATTGCTTGCAGAAACAGCTGGGATGATCGGTGTCCAGGAGATGCGGGATGCCTTCAAGGAGTTTGACACGAATGGAGATGGGGAGATCACCCTGGTGGAGCTACAGCAGGCCATGCAGAGACTCCTGGGGGAGCGGCTCACCCCCCGGGAGATCTCTGAGGTTGTCCGGGAGGCTGATGTTAATGGAGACGGCACAGTTGACTTTGAAGAGTTTGTGAAGATGATGTCTCGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
ORF Viral Vector | vGMAP000501 | Human CABP5 Adenovirus particle |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.